Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth and reproduction. Insertion/deletion (indel) is a relatively simple and effective DNA marker. Therefore, four sheep breeds of various fecundity were used to explore the novel indel variants within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep LHX3 gene was found, and three genotypes were detected. Interestingly, the increasing trends of II (insertion/insertion) genotype frequency and I allelic frequency were the same as the growth of the fertility character. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity breed (TS) based on a χ2 test (P < 0.05). Association analyses showed that body length was significantly different in female TS and STHS and that chest width was significantly different for the female TS and male STHS (P < 0.05). These findings suggested that the 29 bp indel could extend the spectrum of genetic variations of the LHX3 gene in sheep and provide a valuable theoretical basis for the marker-assisted selection (MAS) in sheep breeding and genetics.

Mitochondria is a double membrane‐bound cellular organelle that generates energy to maintain the homeostasis of cells. Immunity‐related GTPase M (IRGM) in human locates at the inner membrane of mitochondria and is best known for its role in regulating autophagy against intracellular pathogens. Previous studies have shown that IRGM is crucial for the normal function of mitochondria, yet, the molecular mechanisms underlying IRGM‐mediated quality control of mitochondria are still not fully understood. In this study, we showed that knocking‐down IRGM inhibits CCCP induced mitophagy in SH‐SY5Y cells. Furthermore, we reported that IRGM decreases the stability of Mitofilin (IMMT, MIC60) in the damaged mitochondria. Knocking down Mitofilin rescues the loss of mitophagy that is observed in the IRGM KD cells, suggesting that IRGM regulates mitophagy through the inhibition of Mitofilin. These data together provide molecular insight regarding how IRGM regulates mitophagy to control the quality of mitochondria.

Melanoma is one of the most aggressive skin cancers and is well known for its high metastatic rate. Studies have shown that epithelial mesenchymal transition (EMT) is essential for melanoma cell metastasis. However, the molecular mechanisms underlying EMT are still not fully understood. We have shown that IRGM1, a member of immunity-related GTPase family that regulates immune cell motility, is highly expressed by melanoma cells. The current study aimed to explore whether and how IRGM1 may regulate melanoma cell metastasis. To test this, we modified IRGM1 expression in B16 melanoma cells. We found that over-expression of IRGM1 substantially enhanced pulmonary metastasis in vivo. In keeping with that, knocking-in IRGM1 strongly enhanced while knocking-down IRGM1 impaired B16 cell migration and invasion ability in vitro. Interestingly, we observed that IRGM1 enhanced F-actin polymerization and triggers epithelial mesenchymal transition (EMT) through a mechanism involved in PIK3CA mediated Rac1 activation. Together, these data reveals a novel molecular mechanism that involved in melanoma metastasis.

This study explored the impact of integrating fermented feed into the starter diet of lambs, focusing on growth, health, serum antioxidants, immune markers, rumen fermentation, and microbial communities. Thirty-six ten-day-old female Tail Han lambs were randomly divided into three experimental groups, which were separately fed with alfalfa hay (LA group), tail vegetable fermented feed (LB group), and tail vegetable fermented feed supplemented with 0.1% microbial inoculants (LC group) during the experimental period. This study assessed the influence of fermented feed on various parameters, including growth performance, fiber degradation, rumen fermentation, enzymatic activities, and ruminal histomorphology. The results indicate that compared to the control group, the addition of fermented feed can increase the daily weight gain of lambs. Simultaneously, the addition of fermented feed can enhance the total antioxidant capacity of serum (p < 0.05). The addition of fermented feed promoted the increased height of villi in the duodenum or jejunum of lambs (p < 0.05), and the ratio of villi height to crypt depth in the LB and LC groups was also improved (p < 0.05). The addition of fermented feed increased the richness and diversity of the rumen microbial community in lambs (p < 0.05), primarily increasing the relative abundance of Ruminococcus_1, Ruminococcaceae_UCG-005, Lachnospiraceae, and Lachnospiraceae_NK4A136_group.

Treatment of adipose-derived stem cell (ADSC) substantially improves the neurological deficits during stroke by reducing neuronal injury, limiting proinflammatory immune responses, and promoting neuronal repair, which makes ADSC-based therapy an attractive approach for treating stroke. However, the potential risk of tumorigenicity and low survival rate of the implanted cells limit the clinical use of ADSC. Cell-free extracts from ADSC (ADSC-E) may be a feasible approach that could overcome these limitations. Here, we aim to explore the potential usage of ADSC-E in treating rat transient middle cerebral artery occlusion (tMCAO). We demonstrated that intravenous (IV) injection of ADSC-E remarkably reduces the ischemic lesion and number of apoptotic neurons as compared to other control groups. Although ADSC and ADSC-E treatment results in a similar degree of a long-term clinical beneficial outcome, the dynamics between two ADSC-based therapies are different. While the injection of ADSC leads to a relatively mild but prolonged therapeutic effect, the administration of ADSC-E results in a fast and pronounced clinical improvement which was associated with a unique change in the molecular signature suggesting that potential mechanisms underlying different therapeutic approach may be different. Together these data provide translational evidence for using protein extracts from ADSC for treating stroke.