Huanglongbing (HLB) is a devastating citrus disease. In this work, we report an HLB resistance regulatory circuit in Citrus composed of an E3 ubiquitin ligase, PUB21, and its substrate, the MYC2 transcription factor, which regulates jasmonate-mediated defense responses. A helitron insertion in the PUB21 promoter introduced multiple MYC2-binding cis-elements to create a regulatory circuit linking the PUB21 activity with MYC2 degradation. Ectopic expression of a natural dominant-negative PUB21 paralog discovered in distant Citrus relatives stabilized MYC2 and conferred resistance to HLB. Antiproteolysis peptides (APPs), identified by artificial intelligence, stabilized MYC2 by binding and inhibiting PUB21 activity. A 14–amino acid peptide, APP3-14, molecularly controlled HLB in greenhouse and field trials. This approach represents a strategy to combat uncultivable pathogens through targeted disease resistance protein stabilization.

Bacterial fruit blotch (BFB), caused by Acidovorax citrulli, seriously affects watermelon and other cucurbit crops, resulting in significant economic losses. However, the pathogenicity mechanism of A. citrulli is not well understood. Plant pathogenic bacteria often suppress the plant immune response by secreting effector proteins. Thus, identifying A. citrulli effector proteins and determining their functions may improve our understanding of the underlying pathogenetic mechanisms. In this study, a novel effector, AopN, which is localized on the cell membrane of Nicotiana benthamiana, was identified. The functional analysis revealed that AopN significantly inhibited the flg22-induced reactive oxygen species burst. AopN induced a programmed cell death (PCD) response. Unlike its homologous protein, the ability of AopN to induce PCD was dependent on two motifs of unknown functions (including DUP4129 and Cpta_toxin), but was not dependent on LXXLL domain. More importantly, the virulence of the aopN mutant of A. citrulli in N. benthamiana significantly decreased, indicating that it was a core effector. Further analysis revealed that AopN interacted with watermelon ClHIPP and ClLTP, which responds to A. citrulli strain Aac5 infection at the transcription level. Collectively, these findings indicate that AopN suppresses plant immunity and activates the effector-triggered immunity pathway.

Bacterial fruit blotch (BFB) is a disease of cucurbit plants caused by Acidovorax citrulli. Although A. citrulli has great destructive potential, the molecular mechanisms of pathogenicity of A. citrulli are not clear, particularly with regard to its type III secreted effectors. In this study, we characterized the type III secreted effector protein, AopV, from A. citrulli strain Aac5. We show that AopV significantly inhibits reactive oxygen species and the expression of PTI marker genes, and helps the growth of Pseudomonas syringae D36E in Nicotiana benthamiana. In addition, we found that the aromatic dehydratase ADT6 from watermelon was a target of AopV. AopV interacts with ADT6 in vivo and in vitro. Subcellular localization indicated ADT6 and AopV were co-located at the cell membrane. Together, our results reveal that AopV suppresses plant immunity and targets ADT6 in the cell membrane. These findings provide an new characterization of the molecular interaction of A. citrulli effector protein AopV with host cells.

Pitaya (Selenicereus costaricensis), a tropical and subtropical fruit of Cactaceae family, become very popular in the fruit consumer market in recent years. In June 2022, plant stunting, reduced yields and galled root symptoms were observed on S. costaricensis plants sampled from a commercial production base in Wuming County (23°10'36.67″ N; 108°40'43.24″ E), Guangxi autonomous region, China. The area of S. costaricensis field we investigated was about 19.9 ha. The incidence of root-knot nematode disease was almost 60%. Roots of twenty S. costaricensis plants were dug up, and many root knots and egg masses were observed. The roots with galls were collected, nematodes at different stages were collected and morphologically identified. Females were annulated, pearly white and globular to pear-shaped. The perineal pattern was oval shaped with the dorsal arch being moderately high to high. Average length of adult females (n = 20): body = 614.4 ± 57.3 μm, stylet lengths = 15.1 ± 0.9 μm, dorsal esophageal gland orifice (DGO) = 4.7 ± 0.6 μm. The tail of the second stage juvenile (J2) was very thin with a bluntly pointed tip. The hyaline tail terminus was clearly defined. Average length of J2 (n = 20): body = 469.5 ± 36.7 μm, stylet lengths = 14.7 ± 0.5 μm, DGO = 3.5 ± 0.4 μm, tail lengths averaged = 43.6 ± 9.7 μm. The males were vermiform, annulated, slightly tapering anteriorly, bluntly rounded posteriorly. Typical characteristics of Meloidogyne enterolobii observed were consistent with those previously described by Yang & Eisenback (1983) and Bulletin (2016). J2s hatched from an individual egg mass were collected for DNA extraction and used for molecular biological identification. The specific primers of M. enterolobii, Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC), was used to validate the pathogen (Long et al. 2006). Approximately 236 bp of the target product was amplified, whereas no product was obtained from M. incognita. Further, the rDNA gene sequences (ITS; ITS1_5.8S_ITS2) and large subunit rDNA gene were amplified by the primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and D2A/D3B (ACAAGTACCGTGAGGGAAAGT/TCGGAAGGAACCAGCTACTA), respectively (Subbotin et al. 2006). The target sequences of 765 bp (GenBank accession no. OQ512155) and 759 bp (OQ512743) were recorded in the NCBI with GeneBank. The sequences showed 100% identity with M. enterolobii in ITSs (KJ146863, JQ082448) and D2/D3 (MF467276, OL681885). To verify reproduction on S. costaricensis (Jindu 1), twelve ten-week-old seedlings (12 pots) cultured on a sterile substrate soil were inoculated with 5,000 J2s from the original population in a greenhouse at 26 ˚C. Noninoculated control were set up at the same time. After 8 weeks, the noninoculated plants (n = 12) did not present galls in the roots. All inoculated plants had galled roots and showed dwarf plant. The average reproductive factor obtained was 11.6 and the mean root gall rating of the samples was 5.3 (rating scale of 0 to 10), confirming the pathogenicity of M. enterolobii to S. costaricensis. The red dragon fruits (Hylocereus polyrhizus) in Hainan Island (China) were reported infected by M. enterolobii in previous report (Long et al. 2022). To our knowledge, this is the first report of M. enterolobii parasitizing S. costaricensis in Guangxi, China. This finding has important implications for the control of M. enterolobii at the place of discovery, which is the major fruit production area.

Bacterial fruit blotch (BFB), caused by Paracidovorax citrulli , severely threatens watermelon production. This study investigates the role of HrpW, an atypical harpin in P. citrulli AAC00‐1, in bacterial virulence and host immune modulation. Bioinformatics analysis revealed HrpW harbours a unique signal peptide and structural features distinct from other harpins. Deletion of hrpW impaired bacterial motility, biofilm formation and virulence, while complementation restored these traits. HrpW suppressed reactive oxygen species (ROS) bursts and mitogen‐activated protein kinase (MAPK) activation in plants but failed to induce programmed cell death (PCD). Crucially, HrpW inhibited the hypersensitive response (HR) triggered by P. citrulli in non‐host tobacco, with Δ hrpW mutant inducing premature HR. RNA‐seq analysis demonstrated HrpW downregulated ClRAR1 expression. Silencing ClRAR1 or ClSGT1 compromised watermelon resistance, and notably, ClRAR1 ‐silenced plants exhibited PCD upon HrpW treatment, indicating HrpW‐mediated PCD suppression is RAR1‐dependent. Importantly, HrpW triggered ubiquitin‐dependent degradation of ClRAR1 and independently disrupted ClRAR1‐ClSGT1 binding, thereby suppressing effector‐triggered immunity (ETI). HrpW translocated into plant cells via the type III secretion system (T3SS), as confirmed by CyaA assays. Intriguingly, low concentrations of HrpW enhanced watermelon resistance to BFB, while high concentrations promoted disease progression, revealing a concentration‐dependent duality. This study unveils HrpW as a multifunctional virulence factor that modulates bacterial fitness, suppresses HR and manipulates host immunity via RAR1 targeting. These findings expand our understanding of harpin‐mediated pathogenicity and offer insights for sustainable BFB management strategies.