Alfalfa (Medicago sativa L.) is one of the most important quality forages worldwide and is cultivated throughout China. Alfalfa is susceptible to a variety of viral diseases during its growth, which has caused huge amounts of commercial losses. However, the profile of the alfalfa virus in China remains ambiguous and the viruses transmitted by Odontothrips loti (Haliday), dominant insect pests in alfalfa, are also poorly understood. In the present study, virus diversity was investigated in the primary alfalfa-growing areas in China. A total of 18 alfalfa viruses were identified through RNA-sequencing (RNA-seq) and reverse transcription-polymerase chain reaction (RT-PCR). Two new plant viruses, Medicago sativa virus 1 (MsV1) and Medicago sativa luteovirus 1 (MsLV1), were detected for the first time. Another four viruses, including the Alfalfa ringspot-associated virus (ARaV), Alfalfa virus F (AVF), Alfalfa enamovirus 1 (AEV1), and Alfalfa deltaparitivirus (ADPV), were reported in China for the first time as well. Both Alfalfa mosaic virus (AMV) and Medicago sativa alphapartitivirus 2 (MsAPV2) are the dominant pathogens, with an infection incidence of 91.7–100%, and 74.4–97.2%, respectively. Additionally, O. loti with first- and second-instar nymphs were shown to acquire the AMV within 0.25 h of feeding on a virus-infected alfalfa. Transmission by thrips to healthy alfalfa plants was also demonstrated. Additionally, we clarified the dynamic changes in the AMV in pre-adult stages of O. loti, which indicated that the AMV is propagated in the nymph stage of O. loti. These findings provide valuable information for understanding the alfalfa virome, confirm the role thrips O. loti plays in alfalfa virus transmission, and improve our fundamental knowledge and management of diseases in China.

The codling moth, Cydia pomonella L. (Lepidoptera, Tortricidae), is a serious invasive pest of pome fruits. Currently, C. pomonella management mainly relies on the application of insecticides, which have driven the development of resistance in the insect. Understanding the genetic mechanisms of insecticide resistance is of great significance for developing new pest resistance management techniques and formulating effective resistance management strategies. Using existing genome resequencing data, we performed selective sweep analysis by comparing two resistant strains and one susceptible strain of the insect pest and identified seven genes, among which, two (glycine receptor and glutamate receptor) were under strong insecticide selection, suggesting their functional importance in insecticide resistance. We also found that eight genes including CYP6B2, CYP307a1, 5-hydroxytryptamine receptor, cuticle protein, and acetylcholinesterase, are potentially involved in cross-resistance to azinphos-methyl and deltamethrin. Moreover, among several P450s identified as positively selected genes, CYP6B2, CYP4C1, and CYP4d2 showed the highest expression level in larva compared to other stages tested, and CYP6B2 also showed the highest expression level in midgut, supporting the roles they may play in insecticide metabolism. Our results provide several potential genes that can be studied further to advance understanding of complexity of insecticide resistance mechanisms in C. pomonella.

Helicoverpa armigera (Hübner) and Ostrinia furnacalis (Guenée) are the most devastating insect pests at the ear stage of maize, causing significant losses to the sweet corn industry. Pesticide control primarily relies on spraying during the flowering stage, but the effectiveness is inconsistent since larvae are beneath husks within hours to a day, making pesticide treatments simpler to avoid. Insufficient understanding of pest activity patterns impedes precise and efficient pesticide control. H. armigera and O. furnacalis in corn fields were monitored in the last few years in Beijing China, and we observed a higher occurrence of both moths during the R1 stage of sweet corn. Moth captures reached the maximum during this stage, with 555–765 moths per hectare corn field daily. The control efficiency of nine synthetic insecticides and five biopesticides was assessed in the field during this period. Virtako, with mineral oil as the adjuvant, appeared to be the most effective synthetic insecticide, with the efficiencies reaching 88% and 87% on sweet and waxy corn, respectively. Pesticide residue data indicated that the corn is safe after 17 days of its use. The most effective bioinsecticide was Beauveria bassiana combined with mineral oil, with 88% and 80% control efficiency in sweet and waxy corn, respectively. These results suggested that spraying effective insecticides 5 days after corn silking could effectively control corn ear pests H. armigera and O. furnacalis. Our findings provide valuable insights for the development of ear pest management strategies in sweet corn.

The bean flower thrip Megalurothrips usitatus (Bagnall) is a severe pest on cowpeas and causes a 20–30% reduction in cowpeas in Hainan, China, with even complete crop failure in severe cases. Spinetoram is currently the most important pesticide against M. usitatus in cowpea production. In the main producing areas of cowpeas in Hainan, however, the efficacy of spinetoram against M. usitatus is not well known. In the present study, we employed the maximum dose bioassay to evaluate the efficacy of the mortality rates of adult thrips at F₀ in spinetoram, freshly collected from 212 field populations of M. usitatus collected from 20 villages in the Yazhou District of Hainan. Our results showed that the mortality rates of these thrip populations exposed to spinetoram were from 3.31% to 100%. Among them, the mortality rates of 66.98% (142/212) of the populations exceeded 80%, while that of 33.96% (72/212) of the populations surpassed 90%. Only a small proportion of 0.47% (1/212) the populations exhibited a mortality rate below 10%, and 4.72% (10/212) displayed rates below 50%. Furthermore, significant differences were also observed in the mortality rates of thrips among different villages. Taken together, the maximum dosage bioassay method is a rapid and easily implemented approach providing valuable insights into the field efficacy of insecticides and offers guidance in determining the optimal dosage required in the field. Spinetoram is still effective against M. usitatus in the main producing areas of cowpeas in Hainan, but caution should be exercised in its combined use with other methods to reduce potential resistance.

Macroptilium atropurpureum (DC.) Urb., commonly known as siratro, is a perennial weed belonging to the Fabaceae family. It is used as a cover crop with many crops such as maize, passion-fruit and rice (Xu et al. 2024). In July 2022, siratro plants exhibiting symptoms of leaf shrinking (Figure S1) were observed growing near cowpea (Vigna unguiculata L. Walp), fields in Sanya, located in the south of Hainan Province, China. To investigate the possible causal agents of the symptoms, 14 leaf samples were collected that includes two asymptomatic (M1 and M11) and 12 symptomatic (M2 - M10 and M12 - M14). Total RNA was individually extracted using the TRIzol Reagent (Life, USA). Subsequently, the 14 RNA extracts were then pooled into two composite samples (M1-M7, and M8-M14), from which two cDNA libraries were prepared using the VAHTS Universal V8 RNA-seq Library Prep Kit for MGI (Vazyme, China). High-throughput sequencing was performed on the DNBSEQ-T7 (Beijing Genomics institution, China) generating paired-end reads of 150 bp. De novo assembly using SPAdes v3.15.5 (with default parameters) yielded, 135,011 and 130,549 contigs from the two pooled samples respectively. BLASTN analysis of assembled contigs identified 170 virus-related sequences: 140 contigs mapped to Cowpea mild mottle virus (CPMMV) (NC_014730), with nucleotide (nt) identities ranging from 71.11% to 83.45%, 29 contigs matched to Bean common mosaic virus (BCMV) (NC_003397), showing 71.99% to 97.72% identities, and one contig, 4,095 nt in length, aligned with Cowpea polerovirus 2 (CPPV2) (NC_034247) sharing 93.64% identity. The CPPV2 contig contained an open reading frame (ORF) located at positions 201-2165 nt, encoding 654 amino acids (aa) protein, that exhibited a similarity of 90.06% to the P1 of BE179 (YP_009352253.1). To validate the presence of the three viruses, the 14 siratro samples were tested by reverse transcription - polymerase chain reaction (RT-PCR) using virus-specific primers pairs encompassing the viral coat protein (CP) genes (Table S1). Out of the 14 samples, three (M1, M7 and M8) were singly infected with CPMMV, while four exhibited mixed infections including two with CPMMV and BCMV (M2 and M3) and two with CPMMV and CPPV2 (M9 and M14) (Figure S2). Consequently, no clear association could be established between the observed symptoms and any single virus. Gel-purified PCR products were cloned into the pMD19-T Vector (Takara, China), and transformed into Escherichia coli DH5α cells (Sangon, Shanghai), and two clones per sample were selected for Sanger sequencing. The CPMMV sequences (PP790736 - PP790742) shared 96.90% - 100.00% nt identity with each other and 97.64% nt identity with sequence of CPMMV-JS (MT366555), CPPV2 (PP790745 and PP790746) shared 98.16% nt identity with each other and 97.66% identity with isolate CPPV2-GD (MZ042662) whereas BCMV (PP790747 and PP790748) shared 99.08% nt identity with each other and 97.85% nt identity with BCMV (KC832501). All three viruses identified in this study are previously known to infect leguminous plants (Gambley et al. 2022; Kwak et al. 2022; Palanga et al. 2017; Saqib et al. 2010). However, this is the first report of CPPV2 infecting siratro, thereby expanding our knowledge its known host range. Additional surveys and biological studies are currently being conducted to assess the significance of M. atropurpureum as a potential virus reservoir for viruses that could impact crop plants.

Vigna unguiculata (L.) Walp. (cowpea) is an important economic vegetable in Sanya, Hainan Province, China. But it is easily infected by various viral diseases, especially cowpea mild mottle virus (CPMMV), bean common mosaic virus (BCMV) and cowpea polevirus 2 (CPPV2), causing symptoms such as yellowing, dwarfism and mosaic of leaves, affecting photosynthesis of cowpea. Weeds are perfect intermediate hosts for crop viruses. In the cowpea fields of Sanya, there are a large number of weeds growing nearby, including Sesbania cannabina (Retz.) Poir. and Physalis angulata (L.). S. cannabina, a species of legume, has high nutritional value as the one of the most admired green-manuring plants widely used in crop field for gaining yield and decreasing the quantity of chemical fertilizer (Tiwari et al. 2004). P. angulata, commonly known as husk tomato, is an annual Solanaceaea vegetable crop grown for its fruits (Ramakrishna Pillai et al. 2022). In July 2022, S. cannabina and P. angulata surrounding one hectare of cowpea fields of Sanya with chlorotic and asymptomatic (Figure S1) were collected, and then their total RNAs were individually extracted by the TRIzol Reagent (Life, USA), and two cDNA libraries (one including the RNA samples of S. cannabina, another including the RNA sample of P. angulata) were subsequently constructed using VAHTS Universal V8 RNA-seq Library Prep Kit (Vazyme, China). High-throughput sequencing was performed on a DNBSEQ-T7 platform (BGI, China) with the 150 bp paired-end method. A total of 40,134,299 and 149,473,308 clean reads were de novo assembled by SPAdes 3.15.5 to generate contigs, followed by BLAST-x/n search in viral genomes in GenBank. From the RNA-seq library of S. cannabina, we identified one contig (6255 nt) that exhibited 96.45% nucleotide identity to the CPMMV isolate CPMMV-JS (MT366555), covering 6033 bp out of 6255 bp (6033/6255) of the contig. Additionally, we found seven contigs (ranging in length from 1870 nt to 8336 nt) in the RNA-seq library of P. angulata that showed 78.92% to 84.15% nucleotide identity to the CPMMV isolate Brunt (OK558693), with specific alignment lengths varying from 669/795 to 4244/5337. CPMMV was verified by reverse transcription - polymerase chain reaction (RT-PCR) detection using specific primer (F: 5'-CTGGCCAAGTGGTTTGTTTT-3', R: 5'- AACCGGGTTTACAATCCACA -3') (Wei et al. 2020). PCR products were extracted from an agarose gel, cloned into the pMD19-T Vector (Takara, China), and transformed into Escherichia coli DH5α cells (Sangon Biotech, Shanghai). Two clones for each PCR product were sequenced by Sanger sequencing. The amplified 1865 bp fragments of S. cannabina (PP790744) and P. angulata (PP790743) had 98.07% identity (1727 bp out to 1761 bp) and 97.92% sequence identity (1739 bp out to 1776 bp) to CPMMV-JS (MT366555). Afterwards, we collected S. cannabina and P. angulata with similar symptoms around two cowpea fields (each field covers an area of about one hectare) in three districts of Sanya, namely Yazhou, Tianya, and Haitang, and conducted CPMMV detection. We found that CPMMV was detected in all six samples. CPMMV, including genus Carlavirus and family Betaflexiviridae, was first identified on cowpea in Ghana in the 1970s. Since then, it has been shown to have a very extensive geographical distribution and a wide natural host range. CPMMV principally infects Fabaceae, it is also able to infect hosts from Solanaceaea, Nyctaginaceae, Cleomaceae, Asteraceae and Lamiaceae (Celli et al. 2016; Lamas et al. 2017; Zanardo and Carvalho 2017). To our knowledge, this is the first report of natural infection of the S. cannabina and P. angulata by CPMMV, which may represent additional reservoirs of this virus in the region. Meanwhile, investigating CPMMV in S. cannabina and P. angulata is crucial for developing integrated strategies to prevent its transmission to economically important plants such as cowpea.