Exosomes are emerging as ideal drug delivery vehicles due to their biological origin and ability to transfer cargo between cells. However, rapid clearance of exogenous exosomes from the circulation as well as aggregation of exosomes and shedding of surface proteins during storage limit their clinical translation. Here, we demonstrate highly controlled and reversible functionalization of exosome surfaces with well-defined polymers that modulate the exosome’s physiochemical and pharmacokinetic properties. Using cholesterol-modified DNA tethers and complementary DNA block copolymers, exosome surfaces were engineered with different biocompatible polymers. Additionally, polymers were directly grafted from the exosome surface using biocompatible photo-mediated atom transfer radical polymerization (ATRP). These exosome polymer hybrids (EPHs) exhibited enhanced stability under various storage conditions and in the presence of proteolytic enzymes. Tuning of the polymer length and surface loading allowed precise control over exosome surface interactions, cellular uptake, and preserved bioactivity. EPHs show fourfold higher blood circulation time without altering tissue distribution profiles. Our results highlight the potential of precise nanoengineering of exosomes toward developing advanced drug and therapeutic delivery systems using modern ATRP methods.

This review provides the biophysicochemical background and recent advances in stability prediction of canonical and non-canonical structures of nucleic acids in various molecular environments and cells.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)₂(qdppz)]²⁺ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T₁₈), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T₁₀–T₁₁–A₁₂. The two remaining wide lateral loops are linked through a third K⁺ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

RNA performs various spatiotemporal functions in living cells. As the solution environments significantly affect the stability of RNA duplexes, a stability prediction of the RNA duplexes in diverse crowded conditions is required to understand and modulate gene expression in heterogeneously crowded intracellular conditions. Herein, we determined the nearest-neighbor (NN) parameters for RNA duplex formation when subjected to crowding conditions with an ionic concentration relevant to that found in cells. Determination of the individual contributions of excluded volume effect and water activity to each of the NN parameters in crowded environments enabled prediction of the thermodynamic parameters and their melting temperatures for plenty of tested RNA duplex formation in vitro and in cell with significant accuracy. The parameters reported herein will help predicting RNA duplex stability in different crowded environments, which will lead to an improved understanding of the stability-function relationship for RNAs in various cellular organelles with different molecular environments.