Viruses transmitted by the sweet potato whitefly (Bemisia tabaci) have been detrimental to the sustainable production of cucurbits in the southeastern USA. Surveys were conducted in the fall of 2019 and 2020 in Georgia, a major cucurbit-producing state of the USA, to identify the viruses infecting cucurbits and their distribution. Symptomatic samples were collected and small RNA libraries were prepared and sequenced from three cantaloupes, four cucumbers, and two yellow squash samples. An analysis of the sequences revealed the presence of the criniviruses cucurbit chlorotic yellows virus (CCYV), cucurbit yellow stunting disorder virus (CYSDV), and the begomovirus cucurbit leaf crumple virus (CuLCrV). CuLCrV was detected in 76%, CCYV in 60%, and CYSDV in 43% of the total samples (n = 820) tested. The level of mixed infections was high in all the cucurbits, with most plants tested being infected with at least two of these viruses. Near-complete genome sequences of two criniviruses, CCYV and CYSDV, were assembled from the small RNA sequences. An analysis of the coding regions showed low genetic variability among isolates from different hosts. In phylogenetic analysis, the CCYV isolates from Georgia clustered with Asian isolates, while CYSDV isolates clustered with European and USA isolates. This work enhances our understanding of the distribution of viruses on cucurbits in South Georgia and will be useful to develop strategies for managing the complex of whitefly-transmitted viruses in the region.

Thrips-transmitted tomato spotted wilt orthotospovirus (TSWV) continues to be a constraint to peanut, pepper, tobacco, and tomato production in Georgia and elsewhere. TSWV is being managed by an integrated disease management strategy that includes a combination of cultural practices, vector management, and growing virus-resistant varieties where available. We used a non-transgenic strategy to induce RNA interference (RNAi)-mediated resistance in tobacco (Nicotiana tabacum) plants against TSWV. Double-stranded RNA (dsRNA) molecules for the NSs (silencing suppressor) and N (nucleoprotein) genes were produced by a two-step PCR approach followed by in vitro transcription. When topically applied to tobacco leaves, both molecules elicited a resistance response. Host response to the treatments was measured by determining the time to symptom expression, and the level of resistance by absolute quantification of the virus. We also show the systemic movement of dsRNA_N from the inoculated leaves to younger, non-inoculated leaves. Post-application, viral siRNAs were detected for up to nine days in inoculated leaves and up to six days in non-inoculated leaves. The topical application of dsRNAs to induce RNAi represents an environmentally safe and efficient way to manage TSWV in tobacco crops and could be applicable to other TSWV-susceptible crops.

Taxonomy: Cotton leafroll dwarf virus (CLRDV) is a member of the genus Polerovirus , family Solemoviridae . Geographical Distribution: CLRDV is present in most cotton‐producing regions worldwide, prominently in North and South America. Physical Properties : The virion is a nonenveloped icosahedron with T = 3 icosahedral lattice symmetry that has a diameter of 26–34 nm and comprises 180 molecules of the capsid protein. The CsCl buoyant density of the virion is 1.39–1.42 g/cm ³ and S _20w is 115–127S. Genome: CLRDV shares genomic features with other poleroviruses; its genome consists of monopartite, single‐stranded, positive‐sense RNA, is approximately 5.7–5.8 kb in length, and is composed of seven open reading frames (ORFs) with an intergenic region between ORF2 and ORF3a. Transmission: CLRDV is transmitted efficiently by the cotton aphid ( Aphis gossypii Glover) in a circulative and nonpropagative manner. Host: CLRDV has a limited host range. Cotton is the primary host, and it has also been detected in different weeds in and around commercial cotton fields in Georgia, USA. Symptoms: Cotton plants infected early in the growth stage exhibit reddening or bronzing of foliage, maroon stems and petioles, and drooping. Plants infected in later growth stages exhibit intense green foliage with leaf rugosity, moderate to severe stunting, shortened internodes, and increased boll shedding/abortion, resulting in poor boll retention. These symptoms are variable and are probably influenced by the time of infection, plant growth stage, varieties, soil health, and geographical location. CLRDV is also often detected in symptomless plants. Control: Vector management with the application of chemical insecticides is ineffective. Some host plant varieties grown in South America are resistant, but all varieties grown in the United States are susceptible. Integrated disease management strategies, including weed management and removal of volunteer stalks, could reduce the abundance of virus inoculum in the field.

Viruses transmitted by whiteflies (Bemisia tabaci) cause severe damage to cucurbits in the southern United States. In the fall of 2020, samples of squash plants (Cucurbita pepo) exhibiting symptoms of yellow mottle, interveinal yellowing, and leaf crumple were collected from an insecticide trial in Tifton, Georgia. Total nucleic acid was isolated using the MagMAX 96 Viral RNA Isolation Kit (ThermoFisher Scientific) following the manufacturer's instructions but without DNase treatment. Polymerase chain reaction (PCR) and reverse transcription (RT)-PCR were carried out to determine the presence of whitefly-transmitted viruses. We identified infection by cucurbit chlorotic yellows virus (CCYV) using primers targeting a 953 nt segment of CCYV RNA1 encoding the RNA dependent RNA polymerase gene (RdRp) (CCYV-RDRP-1515F-5'CTCCGAGTAGATCATCCCAAATC3' and CCYV-RDRP-1515R-5'TCACCAGAAACTCCACAATCTC 3') along with other whitefly-transmitted viruses previously reported in Georgia. CCYV was detected from 27 of the 28 samples tested, while cucurbit yellow stunting disorder virus (CYSDV; Polston et al., 2008) and cucurbit leaf crumple virus (CuLCrV; Gadhave et al., 2020) were detected from 23 and 28 squash samples, respectively, with all three viruses regularly occurring as mixed infections. The presence of CCYV was further confirmed by amplification of portions of two different genomic segments from RNA2, including a section of the heat-shock protein (HSP) homolog gene (Bananej et al. 2013) as well as a portion of the coat protein (CP) gene which was amplified using primers CCYV_CPF-5'TCCCGGTGCCAACT GAGACA3' and CCYV_CPR- 5' TACGCGCGGCAGAGGAATTT 3'. The respective 462 bp HSP and 375 bp CP amplicons were cloned and sequenced. The partial coat protein gene sequence (MW251342) was 97.86% identical to a CCYV isolate from Shanghai (KY400633). The partial HSP sequence (MW251341) shared 99.73% identity with the recently identified CCYV isolate from California (MH806868). Criniviruses are an emerging group of whitefly-transmitted viruses responsible for worldwide losses of billions of dollars annually (Tzanetakis et al., 2013). CCYV, a member of the genus Crinivirus, was believed to be restricted to Asia, Africa, and the Mediterranean regions of Europe (Bananej et al., 2013; Orfanidou et al., 2014) until it was recently identified in the Imperial Valley of California (Wintermantel et al., 2019). Southern Georgia has been experiencing high whitefly populations, resulting in the emergence of CuLCrV and CYSDV on vegetables in recent years. Because CCYV can produce symptoms virtually identical to those of CYSDV and occurs in mixed infections in cucurbits with other whitefly-transmitted viruses, its epidemiology, role in disease incidence, severity, and impact on economically important crops in the southeastern United States will require further investigation.