PFOA, a newly emerging persistent organic pollutant, is widely present in various environmental media. Previous reports have proved that PFOA exposure can accumulate in the ovary and lead to reproductive toxicity in pregnant mice. However, the potential mechanism of PFOA exposure on fertility remains unclear. In this study, we explore how PFOA compromises fertility in the zebrafish. The data show that PFOA (100 mg/L for 15 days) exposure significantly impaired fertilization and hatching capability. Based on tissue sections, we found that PFOA exposure led to ovarian damage and a decrease in the percentage of mature oocytes. Moreover, through in vitro incubation, we determined that PFOA inhibits oocyte development. We also sequenced the transcriptome of the ovary of female zebrafish and a total of 284 overlapping DEGs were obtained. Functional enrichment analysis showed that 284 overlapping DEGs function mainly in complement and coagulation cascades signaling pathways. In addition, we identified genes that may be associated with immunity, such as LOC108191474 and ZGC:173837. We found that exposure to PFOA can cause an inflammatory response that can lead to ovarian damage and delayed oocyte development.

In this study, we determined the complete mitochondrial genome of Neolissochilus heterostomus. The genome is 16,585 bp in length, including 2 ribosomal RNA genes, 13 proteins-coding genes, 22 transfer RNA genes, and two non-coding control regions. Sequence analysis showed that the overall base composition of N. heterostomus is T 24.8%, C 27.7%, A 31.7%, and G 15.8%. The sequence is a slight A + T bias of 56.5%, which is similar to other fishes. We describe a phylogenetic analysis of 16 species of Cypriniformes based on the complete mitochondrial genome, and the result showed that N. stracheyi is most closely related to N. heterostomus. This mitogenome sequence data would play an important role in the investigation of phylogenetic relationship of the Cyprinidae.

Background: There are not many species of turtles and some species have become rare or even endangered due to the changes in the ecological environment, the destruction of human pet market trade, the use of food and medicinal materials and other factors. The phylogenetic study of Geoemyda spengleri and their related species will help to protect turtle germplasm resources. Methods: The sample was collected from nature reserves in Guangxi, China and processed for DNA isolation and confirmed with Polymerase chain reaction (PCR). Maximum-likelihood (ML) were conducted based on concatenated sequences of 13 protein-coding genes from mitochondrial genomes of 25 taxa. Result: The complete mitochondrial genome (17,448 bp) from the Black-breasted leaf turtle (Geoemyda spengleri) was determined. The genome content, gene order and base composition conformed to the consensus vertebrate type mtDNA. However, a remarkable feature was found in this molecule: a small number of (ATATTATTATATTATTATATATC)n direct tandem repeats followed by a AT-enriched microsatellite sequence at the 3’ end of the control region (D-loop), which might be useful as molecular markers for studying population genetics and helpful for species identification and conservation. The results strongly supported that 1) Geoemyda spengleri and the most recent common ancestor of Batagur trivittata and Pangshura sylhetensis formed a monophyletic clade, whereas most other species of Geoemydidae formed another branch, suggesting that Geoemyda and Batagur trivittata may have more closely relationships than other genera; 2) the Geoemydidae with Testudinidae was a sister group rather than with the Emydidae. Furthermore, In order to analyze the relationship between habitat distribution and the phylogenetic evolution of turtles, the habitat distribution map was plotted based on the habitat distribution of species of Geoemydidae. The results also supported that Geoemyda spengleri and Batagur trivittata may relatively have intimate relationships.