Mammary epithelial cells (MECs) affect milk production capacity during lactation and are critical for the maintenance of tissue homeostasis. Our previous studies have revealed that the expression of miR-152 was increased significantly in MECs of cows with high milk production. In the present study, bioinformatics analysis identified ACAA2 and HSD17B12 as the potential targets of miR-152, which were further validated by dual-luciferase repoter assay. In addition, the expressions of miR-152 was shown to be negatively correlated with levels of mRNA and protein of ACAA2, HSD17B12 genes by qPCR and western bot analysis. Furthermore, transfection with miR-152 significantly up-regulated triglyceride production, promoted proliferation and inhibited apoptosis in MECs. Furthermore, overexpression of ACAA2 and HSD17B12 could inhibit triglyceride production, cells proliferation and induce apoptosis; but sh234-ACAA2-181/sh234-HSD17B12-474 could reverse the trend. These findings suggested that miR-152 could significantly influence triglyceride production and suppress apoptosis, possibly via the expression of target genes ACAA2 and HSD17B12.

Accumulating evidence indicates that ferroptosis is an iron-dependent form of regulated cell death. This type of iron-dependent programmed cell death is different from traditional forms of regulated cell death, such as apoptosis and autophagy. However, the role of ferroptosis in porcine oocyte maturation and the associated mechanism remain unclear. In the present research, we investigated the effects of ferric ammonium citrate (FAC), a specific ferroptosis inducer, on porcine oocyte meiotic maturation and quality and subsequent embryonic developmental competence. FAC treatment caused obvious accumulation of intracellular ferrous ions in porcine oocytes. At the end of the in vitro maturation (IVM) period, there was a significant decrease in the polar body (PB) extrusion rate and an increase in the percentage of abnormal oocytes in the FAC treatment groups, indicating that iron overload-induced ferroptosis may suppress the meiotic process during porcine oocyte maturation. We also found that after FAC treatment, the subsequent two-cell rate, four-cell rate and blastocyst formation rate were significantly decreased in porcine parthenogenetic activation (PA) embryos, indicating that iron overload-induced ferroptosis decreased porcine oocyte quality. Further analysis revealed that FAC treatment not only enhanced intracellular reactive oxygen species (ROS) generation, decreased intracellular free thiol levels and induced mitochondrial dysfunction but also triggered autophagy in porcine oocytes. Taken together, these findings suggest that iron overload-induced ferroptosis impairs porcine oocyte meiosis and decreases porcine oocyte quality, possibly by increasing oxidative stress, inducing mitochondrial dysfunction and triggering autophagy.

Our previous study showed that the expression of miR-196a was significantly higher in immature porcine testes than in mature porcine testes. However, the role of miR-196a in immature Sertoli cells remains unclear. In this study, miR-196a mimics, miR-196a inhibitor, and microRNA-small hairpin negative control (miRNA-ShNC) were transfected into immature Sertoli cells, respectively. Subsequently, the cell cycle and apoptosis rate of the immature Sertoli cells were measured by flow cytometry, and the viability of the Sertoli cells was measured by the MTS assay. Furthermore, the candidate target genes of miR-196a were analyzed by bioinformatics, and the target genes were validated by dual luciferase reporter assays, then the expression of target genes was detected by real-time quantitative polymerase chain reaction (RT-qPCR) and Western blot assays. The results showed that miR-196a promotes the proliferation and inhibits the apoptosis of immature Sertoli cells. miR-196a directly binds the 3′ untranslated region (3′ UTR) of RCC2 and ABCB9. The expression of miR-196a was shown to be negatively correlated with the messenger RNA and protein levels of the RCC2 and ABCB9 genes. The study demonstrates that miR-196a regulates immature Sertoli cell proliferation and apoptosis and inhibits the expression of RCC2 and ABCB9.

5′CCGCTCGAGTAGAAACAGACTGGCTCCAACAC 3′