Dihydroartemisinin (DHA), an artemisinin derivate, has been investigated as a potential antitumor drug in primary liver cancer (PLC). Ferroptosis is a form of iron‑dependent cell death that can be driven by lipid peroxidation inducers. The present study aimed to determine whether and how DHA could promote the death of PLC cells by inducing ferroptosis. In total, four PLC cell lines with different p53 statuses, including Hep3B (p53 null), Huh7 (p53 mutant), PLC/PRF/5 (p53 mutant) and HepG2 (p53 wild‑type), were treated with various concentrations of DHA. The effects of DHA on all three branches of the unfolded protein response (UPR) were evaluated. To deactivate the UPRs, small interfering RNA was used to knockdown the expression of activating transcription factor (ATF)4, X‑box binding protein 1 (XBP1) or ATF6 in PLC cells. The effect of DHA on the promoter activity of Chac glutathione specific γ‑glutamylcyclotransferase 1 (CHAC1) was evaluated using a dual luciferase reporter assay. The results revealed that DHA‑induced death in PLC cells was irrelevant of the p53 status. PLC cells exposed to DHA displayed classic features of ferroptosis, such as increased lipid reactive oxygen species and malondialdehyde levels, an iron overload, and decreased activity or expression of glutathione (GSH), glutathione peroxidase 4, solute carrier family (SLC) 7 member 11 and SLC family 3 member 2. The antitumor effects of DHA in PLC cells were significantly weakened by two typical ferroptosis inhibitors, ferrostatin‑1 and deferoxamine mesylate salt, whereas the antitumor effects were augmented following iron overload. Furthermore, DHA activated all three branches of the UPR (eukaryotic translation initiation factor 2 α kinase 3/eukaryotic translation initiation factor 2A/ATF4, inositol‑requiring transmembrane kinase/endoribonuclease 1α/XBP1 and ATF6 branches) in vitro. Notably, DHA‑induced ferroptosis was significantly attenuated following the knockdown of ATF4, XBP1 or ATF6 expression. In addition, the promoter activity of CHAC1, a gene capable of degrading GSH, was enhanced by DHA, but weakened when the aforementioned three UPR transcription factors were knocked down. In conclusion, the findings of the present study suggested that DHA may effectively induce ferroptosis in PLC cells through the activation of anti‑survival UPRs and the upregulation of CHAC1 expression.

Acute intermittent porphyria (AIP) is caused by hydroxymethylbilane synthase (HMBS) gene mutation. A Chinese female patient with very typical AIP symptoms of severe abdominal pain, seizures, hypertension, and tachycardia, accompanied with hyponatremia, anemia, and hyperbilirubinemia. She was diagnosed as AIP based on positive result of urine porphobilinogen and her clinical syndrome. The proband was treated with intravenous glucose (at least 250 g per day) for 4 days. HMBS mutation was investigated in this family by Sanger sequencing. A heterozygous mutation of the HMBS gene was identified in the proband and 7 other family members. Genetic sequencing showed a deletion of 55 basepairs (C.1078_1132delGCCCATTAACTGGTTTGTGGGGCACAGATGCCTGGGTTGCTGCTGTCCAGTGCCT) including the stop codon position, leading to frameshift mutation. The mutation has not been documented in current gene databases. Further prediction of mutated protein structure suggests that the mutation is likely to produce prolonged peptide with structural change and less stability. Physicians should pay attention to AIP attack in patients with suspected symptoms and make use of genetic testing to increase identification of mutated HMBS gene carriers for further preventive strategy.