This document provides a comprehensive summary of evidence on the current situation of rare diseases (RDs) globally and regionally, including conditions, practices, policies, and regulations, as well as the challenges and barriers faced by RD patients, their families, and caregivers. The document builds on a review of academic literature and policies and a process of validation and feedback by a group of seven experts from across the globe. Panelists were selected based on their academic merit, expertise, and knowledge regarding the RD environment. The document is divided into five main sections: (1) methodology and objective; (2) background and context; (3) overview of the current situation and key challenges related to RDs covering six dimensions: burden of disease, patient journey, social impact, disease management, RD-related policies, and research and development; (4) recommendations; and (5) conclusions. The recommendations are derived from the discussion undertaken by the experts on the findings of this review and provide a set of actionable solutions to the challenges and barriers to improving access to RD diagnosis and treatment around the world. The recommendations can support critical decision-making, guiding efforts by a broad range of RDs stakeholders, including governments, international organizations, manufacturers, researchers, and patient advocacy groups.

Chromosomal microarray (CMA) is now recognized as the first-tier genetic test for detection of copy number variations (CNVs) in patients with autism spectrum disorder (ASD). The aims of this study were to identify known and novel ASD associated-CNVs and to evaluate the diagnostic yield of CMA in Thai patients with ASD. The Infinium CytoSNP-850K BeadChip was used to detect CNVs in 114 Thai patients comprised of 68 retrospective ASD patients (group 1) with the use of CMA as a second line test and 46 prospective ASD and developmental delay patients (group 2) with the use of CMA as the first-tier test. We identified 7 (6.1%) pathogenic CNVs and 22 (19.3%) variants of uncertain clinical significance (VOUS). A total of 29 patients with pathogenic CNVs and VOUS were found in 22% (15/68) and 30.4% (14/46) of the patients in groups 1 and 2, respectively. The difference in detected CNV frequencies between the 2 groups was not statistically significant (Chi square = 1.02, df = 1, P = 0.31). In addition, we propose one novel ASD candidate gene, SERINC2, which warrants further investigation. Our findings provide supportive evidence that CMA studies using population-specific reference databases in underrepresented populations are useful for identification of novel candidate genes.

Waardenburg syndrome (WS) is a prevalent hearing loss syndrome, concomitant with focal skin pigmentation abnormalities, blue iris, and other abnormalities of neural crest-derived cells, including Hirschsprung’s disease. WS is clinically and genetically heterogeneous and it is classified into four major types WS type I, II, III, and IV (WS1, WS2, WS3, and WS4). WS1 and WS3 have the presence of dystopia canthorum, while WS3 also has upper limb anomalies. WS2 and WS4 do not have the dystopia canthorum, but the presence of Hirschsprung’s disease indicates WS4. There is a more severe subtype of WS4 with peripheral nerve and/or central nervous system involvement, namely peripheral demyelinating neuropathy, central dysmyelinating leukodystrophy, WS, and Hirschsprung’s disease or PCW/PCWH. We characterized the genetic defects underlying WS2, WS4, and the WS4-PCW/PCWH) using Sanger and whole-exome sequencing and cytogenomic microarray in seven patients from six unrelated families, including two with WS2 and five with WS4. We also performed multiple functional studies and analyzed genotype–phenotype correlations. The cohort included a relatively high frequency (80%) of individuals with neurological variants of WS4. Six novel SOX10 mutations were identified, including c.89C > A (p.Ser30^∗), c.207_8 delCG (p.Cys71Hisfs^∗62), c.479T > C (p.Leu160Pro), c.1379 delA (p.Tyr460Leufs^∗42), c.425G > C (p.Trp142Ser), and a 20-nucleotide insertion, c.1155_1174dupGCCCCACTATGGCTCAGCCT (p.Phe392Cysfs^∗117). All pathogenic variants were de novo. The results of reporter assays, western blotting, immunofluorescence, and molecular modeling supported the deleterious effects of the identified mutations and their correlations with phenotypic severity. The prediction of genotype–phenotype correlation and functional pathology, and dominant negative effect vs. haploinsufficiency in SOX10-related WS were influenced not only by site (first two vs. last coding exons) and type of mutation (missense vs. truncation/frameshift), but also by the protein expression level, molecular weight, and amino acid content of the altered protein. This in vitro analysis of SOX10 mutations thus provides a deeper understanding of the mechanisms resulting in specific WS subtypes and allows better prediction of the phenotypic manifestations, though it may not be always applicable to in vivo findings without further investigations.

The OTUD6B and ZMIZ1 genes were recently identified as causes of syndromic intellectual disability (ID) with shared phenotypes of facial dysmorphism, distal limb anomalies, and seizure disorders. OTUD6B- and ZMIZ1-related ID are inherited in autosomal recessive and autosomal dominant patterns, respectively. We report a 5-year-old girl with developmental delay, facial phenotypes resembling Williams syndrome, and cardiac defects. The patient also had terminal broadening of the fingers and polydactyly. Cytogenomic microarray (CMA), whole exome sequencing (WES), and mRNA analysis were performed. The CMA showed a paternally inherited 0.118 Mb deletion of 8q21.3, chr8:92084087–92202189, with OTUD6B involved. The WES identified a hemizygous OTUD6B variant, c.873delA (p.Lys291AsnfsTer3). The mother was heterozygous for this allele. The WES also demonstrated a heterozygous ZMIZ1 variant, c.1491 + 2T > C, in the patient and her father. This ZMIZ1 variant yielded exon 14 skipping, as evidenced by mRNA study. We suggest that Williams syndrome-like phenotypes, namely, periorbital edema, hanging cheek, and long and smooth philtrum represent expanded phenotypes of OTUD6B-related ID. Our data expand the genotypic spectrum of OTUD6B- and ZMIZ1-related disorders. This is the first reported case of a compound heterozygote featuring point mutation, chromosomal microdeletion of OTUD6B, and the unique event of OTUD6B, coupled with ZMIZ1 variants.

MITF is a known gene underlying autosomal dominant hearing loss, Waardenburg syndrome (WS). Biallelic MITF mutations have been found associated with a rare hearing loss syndrome consisting eye abnormalities and albinism; and a more severe type of WS whose heterozygous parents were affected with classic WS in both cases. The aims of this study were to identify a new candidate gene causing autosomal recessive nonsyndromic hearing loss (ARNSHL) and confirm its causation by finding additional families affected with the candidate gene and supporting evidences from functional analyses. By using whole exome sequencing, we identified a homozygous c.1022G>A: p.Arg341His variant of MITF, which co-segregated with the hearing loss in five affected children of a consanguineous hearing couple. Targeted exome sequencing in a cohort of 130 NSHL individuals, using our in-house gene panel revealed a second family with c.1021C>T: p.Arg341Cys MITF variant. Functional studies confirmed that the Arg341His and Arg341Cys alleles yielded a normal sized MITF protein, with aberrant cytosolic localization as supported by the molecular model and the reporter assay. In conclusion, we demonstrate MITF as a new cause of ARNSHL, with heterozygous individuals free of symptoms. MITF should be included in clinical testing for NSHL, though it is rare.