Poleroviruses are not mechanically transmittable by sap inoculation, which makes their isolation and multiplication in laboratory hosts for virion extraction and genome sequence analysis difficult. A reverse‐transcription polymerase chain reaction (RT‐PCR) procedure was modified to amplify the entire genomes of cucurbit‐infecting poleroviruses in three sections directly from RNA extracts from infected plant field samples. The procedure was used to determine the first full‐length genome nucleotide sequences of four polerovirus isolates from field samples collected in Taiwan. TW1 was identified as Melon aphid‐borne yellows virus (MABYV), because it had 90% for P3 and P3‐5 and aa identities of 78–88% for all the other proteins. TW19 represents the first full‐length sequence for the recently described Suakwa aphid‐borne yellows virus (SABYV). The deduced aa sequences for all the proteins of TW19 showed >10% variation compared to all other poleroviruses, though recombination analysis suggested MABYV as the major parent and an unidentified polerovirus as minor parent. R‐TW82 was identified as a strain of CABYV, as the deduced CP aa sequence showed >90% identity to that of other CABYV isolates, and recombination analysis suggested that MABYV was the major parent with CABYV the minor parent. Comparative details of the new full‐length sequences and their implications on criteria for distinguishing polerovirus species are discussed.

Cucurbits are important crops in the world. However, leaf curl disease constrains their production. Here, begomovirus diversity and pathogenicity associated with the disease in Malaysia were studied based on 49 begomovirus-detected out of 69 symptomatic plants from seven cucurbit crops in 15 locations during 2016 and 2017. The presence of Squash leaf curl China virus (SLCCNV) and Tomato leaf curl New Delhi virus (ToLCNDV) were confirmed by virus detection by polymerase chain reaction, viral DNA sequence analysis and specific detection of the viral components. ToLCNDV Malaysian isolates were further distinguished into strains A, B, C and D. Virus co-infection was detected in bitter gourd, bottle gourd and squash. Among them, eight bitter gourd samples were detected without SLCCNV DNA-A. However, one bottle gourd and five squash samples were without ToLCNDV DNA-B. Pseudorecombination of ToLCNDV DNA-A and SLCCNV DNA-B was detected in two bitter gourd samples. The pathogenic viruses and pseudorecombinants were confirmed by agroinoculation. The viral DNA-B influencing on symptomology and host range was also confirmed. The results strengthen the epidemic of cucurbit-infecting begomovirus in Malaysia as well as Southeast Asia. Especially, the natural pseudorecombinant of begomovirus that extends host range and causes severe symptom implies a threat to crops.

During the 2006 winter and 2007 spring seasons, tomato lines carrying the Ty2 gene, which confers resistance to the Tomato leaf curl Taiwan virus (GenBank Accession No. U88692), showed severe yellowing, leaf curl, and stunting symptoms in several locations in Tainan County, Taiwan. Whiteflies were found to be associated with symptomatic plants, and disease incidences of almost 100% were observed. The presence of a new resistance breaking begomovirus was suspected. Six symptomatic leaf samples of three different tomato plants from each infected field were collected in Liouying (LY3, 7, and 8) and Sigang (SG9, 13, and 18) townships in Tainan County. Viral DNAs were extracted (2), and PCR with previously described primers was used to detect the presence of begomoviral DNA-A (4), DNA-B (3), and associated satellite DNA (1). Begomoviral DNA-A was detected in all tested samples. The PCR-amplified 1.5-kb viral DNA-A from one positive sample from each location (LY3 and SG18) was cloned and sequenced. On the basis of the 1.5 kb DNA-A sequences, specific primers were designed for cloning and sequencing the complete viral DNA-A, which was 2,744 bp for both the Liouying (GenBank Accession No. EF577266) and Sigang (GenBank Accession No. EF577264) isolates. Sequence analyses were conducted with DNAMAN sequence analysis software (Lynnon Corporation, Vaudreuil, Quebec, Canada). The DNA-A of both isolates contained the conserved nanonucleotides-TAATATTAC and six open reading frames, including two in the virus sense (AV1 and AV2) and four in the complementary sense (AC1 to AC4). On the basis of their 99.5% nucleotide identity, they are considered isolates of the same species. BLASTn analysis and sequence comparison with those available in the GenBank database ( http://www.ncbi.nlm.nih.gov ) indicated that the two isolates had the highest nucleotide identity (more than 98.4%) with the DNA-A of the Tomato yellow leaf curl Thailand virus (TYLCTHV; GenBank Accession No. AY514631). Virus-associated satellite DNA was not found in any of the samples. However, DNA-B was detected in all six samples, providing further evidence that the two isolates were the same as the bipartite TYLCTHV. All samples, except the LY3, were also found to be infected with Tomato leaf curl Taiwan virus (ToLCTWV), as indicated by a positive PCR reaction using the ToLCTWV-specific primer pair KD-PAV1 (5′ATCGTGTTGGGAAGAGGTTT3′) and KD-PAC1 (5′GGAGAAAGCTCCCAAAGATT3′). A pure TYLCTHV isolate of LY3 was obtained in Lycopersicum esculentum TK70 by transmission with Bemisia tabaci Biotype B. The isolated TYLCTHV was found to infect L. esculentum H24 (resistant to ToLCTWV) and induce typical yellow leaf curl symptoms. To our knowledge, this is the first report of the presence of TYLCTHV in Taiwan. References: (1) R. W. Briddon et al. Virology 312:106, 2003. (2) R. L. Gilbertson et al. J. Gen. Virol. 72:2843, 1991. (3) S. K. Green et al. Plant Dis. 85:1286, 2001. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Viruses that cause tomato yellow leaf curl disease are part of a group of viruses of the genus Begomovirus, family Geminiviridae. Tomato-infecting begomoviruses cause epidemics in tomato crops in tropical, subtropical, and Mediterranean climates, and they are exclusively transmitted by Bemisia tabaci in the field. The objective of the present study was to examine the transmission biology of the tomato yellow leaf curl Thailand virus (TYLCTHV) by B. tabaci, including virus-infected tissues, virus translocation, virus replication, and transovarial transmission. The results demonstrated that the virus translocates from the alimentary gut to the salivary glands via the hemolymph, without apparent replication when acquired by B. tabaci. Furthermore, the virus was detected in 10% of the first-generation progeny of viruliferous females, but the progeny was unable to cause the viral infection of host plants. There was no evidence of transovarial transmission of TYLCTHV in B. tabaci. When combined with the current literature, our results suggest that B. tabaci transmits TYLCTHV in a persistent-circulative mode. The present study enhances our understanding of virus–vector interaction and the transmission biology of TYLCTHV in B. tabaci.