Bread-making quality is a crucial trait for wheat and triticale breeding. Several genes significantly influence these characteristics, including glutenin genes and the wheat bread-making (wbm) gene. World wheat collection screening showed that only a few percent of cultivars carry the valuable wbm variant, providing a useful source for wheat breeding. In contrast, no such analysis has been performed for triticale (wheat (AABB genome) × rye (RR) amphidiploid) collections. Despite the importance of the wbm gene, information about its origin and genomic organization is lacking. Here, using modern genomic resources available for wheat and its relatives, as well as PCR screening, we aimed to examine the evolution of the wbm gene and its appearance in the triticale genotype collection. Bioinformatics analysis revealed that the wheat Chinese Spring genome does not have the wbm gene but instead possesses the orthologous gene, called wbm-like located on chromosome 7A. The analysis of upstream and downstream regions revealed the insertion of LINE1 (Long Interspersed Nuclear Elements) retrotransposons and Mutator DNA transposon in close vicinity to wbm-like. Comparative analysis of the wbm-like region in wheat genotypes and closely related species showed low similarity between the wbm locus and other sequences, suggesting that wbm originated via introgression from unknown species. PCR markers were developed to distinguish wbm and wbm-like sequences, and triticale collection was screened resulting in the detection of three genotypes carrying wbm-specific introgression, providing a useful source for triticale breeding programs.

Одно из самых опасных заболеваний томата – фузариозное увядание (Fusarium wilt), возбудитель которого – фитопатогенный гриб Fusarium oxysporum f. sp. lycopersici. Наиболее эффективный метод борьбы с этой болезнью – выращивание устойчивых сортов и гибридов томата. В настоящее время анализ растений по аллелям генов устойчивости успешно проводят с использованием молекулярных маркеров, которые позволяют выявить различия изучаемых образцов на уровне ДНК. Цель исследований – молекулярно-генетический анализ гибридов томата F1 селекции агрофирмы «Поиск» по устойчивости к фузариозу (ген I2). В качестве объекта исследования были взяты 17 гибридов томата F1 разных товарных групп (крупноплодные, кистевые, коктейль, черри). Исследования проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. Для идентификации аллелей гена I2использовали функциональный маркер I-2 c праймерами I-2/5F (CAAGGAACTGCGTCTGTCTG) и I-2/5R (ATGAGCAATTTGTGGCCAGT). ПЦР проводили в амплификаторе Termal Cycler Bio-Rad T 100, визуализацию результатов проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000. При идентификации гена устойчивости I2 к фузариозу у изучаемых гибридов томата F1 были выявлены фрагменты 633 п.н. (аллель I-2) и 566 п.н. (аллель I-2C), что указывает на их устойчивость к этому заболеванию. Установлено, что из 17 исследуемых гибридов 16 – устойчивы к фузариозу, из них 4 – доминантные гомозиготы по гену I2(аллели I-2). Гибрид F1 835/19 содержит в генотипе оба аллеля устойчивости: I-2 и I-2C. С целью проверки эффективности исследуемого гена I2 планируется оценка гибридов томата F1 методом искусственного заражения в фазе сеянцев (расы 1 и 2 Fusarium oxysporumf.sp. lycopersici). При подтверждении результатов маркерного анализа доминантные гомозиготы по гену I2 будут использованы в селекционном процессе для создания линий-доноров к фузариозу. One of the most dangerous diseases of tomato is fusarium wilt, caused by phytopathogenic fungus Fusarium oxysporum f. sp. lycopersici. The growing of tomato resistant varieties and hybrids is the most effective method to control this disease. Now plant analysis for alleles of resistance genes is successfully carried out using molecular markers that allow to identify differences in studied samples at DNA level. The aim of the research is a molecular genetic analysis of tomato F1 hybrids selected by the Poisk AgroFirm for resistance to fusarium wilt (gene I2). As an object of research, 17 hybrids of tomato F1 of different product groups (large-fruited, brush, cocktail, cherry) were taken. The analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. The functional marker I-2 with primers I-2/5F (CAAGGAACTGCGTCTGTCTG) and I-2/5R (ATGAGCAATTTGTGGCCAGT) was used to identify I2 gene alleles. The PCR was carried out in the Termal Cycler Bio-Rad T 100 amplifier, the results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer and were analyzed using the Gel Doc 2000 system. The fragments 633 bp (I-2allele) and 566 bp (I-2C allele) in investigated tomato hybrids indicate their resistance to this disease. Among 17 hybrids 16 are resistant to fusarium wilt, 4 hybrids from them are dominant homozygotes for I2 gene (I-2alleles). Hybrid F1 835/19 has both I-2 and I-2Calleles. To test the I2 gene effectiveness it is planned to assess tomato F1 hybrids by artificial inoculation in seedling phase (Fusarium oxysporum f. sp. lycopersici races 1 and 2). Dominant homozygotes for I2 gene will be used in breeding programs for creating donor lines of resistance to fusarium wilt if the results of marker analysis are confirmed.

В статье представлены результаты молекулярно-генетического анализа F1 гибридов томата разных товарных групп на наличие аллелей гена устойчивости Cf-9 к кладоспориозу. Молекулярно-генетический анализ проводили в лаборатории маркерной и геномной селекции растений ФГБНУ ВНИИСБ в 2019 году. В качестве объекта исследования использованы 16 F1 гибридов томата, в том числе 10 крупноплодных, 1 кистевой, 1 коктейль и 4 черри. Повторность исследований двухкратная (одна повторность – одно растение). Для идентификации аллелей гена Cf-9 устойчивости к кладоспориозу применяли SCAR-маркер со следующими праймерами: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). Реакционная смесь для ПЦР объемом 25 мкл содержала 50–100 нг ДНК, 2,5 мМ dNTP, 3 мМ MgSO4, 10 пМ каждого праймера, 2 ед. Taq-полимеразы (ООО «НПФ Синтол») и 2х стандартный ПЦР буфер. Реакцию проводили в амплификаторе Termal Cycler Bio-Rad T 100 по программе 95 °C – 5 мин, 35 циклов 95 °C – 20 с, 60 °C – 30 с, 72 °C – 30 с, финальная элонгация в течение 5 мин при 72 °C. Визуализацию результатов ПЦР проводили путем электрофореза в 1,7%-ном агарозном геле с 1х ТАЕ буфером, результаты анализировали с помощью системы Gel Doc 2000 (Bio-Rad Laboratories, Inc., США). При идентификации гена устойчивости Cf-9 к кладоспориозу у изучаемых гибридов томата F1 были выявлены фрагменты размером 378 п. н. (аллель Cf-9) и 507 п. н. (аллель 9DC), что указывает на их устойчивость к этому заболеванию. Согласно результатам исследований, из 16 F1 гибридов томата 13 устойчивы к кладоспориозу, причем у 12 из них выявлено наличие только аллелей Cf-9, 1 гибрид имеет в генотипе оба аллеля устойчивости – Cf-9 и 9DС. Доминантные гомозиготы по гену Cf-9 будут использованы в селекционных программах Агрофирмы «Поиск» для создания линий-доноров устойчивости к кладоспориозу. The article presents the results of molecular genetic analysis of F1 tomato hybrids of different commodity groups for presence of Cf-9 gene alleles of resistance to leaf mold. The molecular genetic analysis was carried out in the laboratory of marker and genomic plant breeding of FSBSI VNIISB in 2019. 16 F1 tomato hybrids were used as the object of the study, including 10 large-fruited, 1 brush, 1 cocktail and 4 cherry. The repetition of studies is two-fold (one frequency – one plant). To identify alleles of the Cf-9gene for cladosporiosis resistance, a SCAR marker with the following primers was used: CS5 (TTTCCAACTTACAATCCCTTC), DS1 (GAGAGCTCAACCTTTACGAA), CS1 (GCCGTTCAAGTTGGGTGTT). The reaction mixture for PCR with a volume of 25 µl contained 50–100 ng of DNA, 2.5 mM dNTP, 3 mM MgSO4, 10 pM of each primer, 2 units. Taq-polymerase (LLC NPF Synthol) and 2x standard PCR buffer. The reaction was carried out in the Termal Cycler Bio-Rad T 100 amplifier according to the program 95 °C – 5 min, 35 cycles 95 °C – 20 s, 60 °C – 30 s, 72 °C – 30 s, the final elongation for 5 minutes at 72 °C. The PCR results were visualized by electrophoresis in a 1.7% agarose gel with 1x TAE buffer, the results were analyzed using the Gel Doc 2000 system (Bio-Rad Laboratories, Inc., USA). The identification of the Cf-9resistance gene to cladosporiosis in the studied tomato F1 hybrids revealed fragments of 378 bp (Cf-9 allele) and 507 bp (9DC allele), which indicates their resistance to this disease. According to the research results, 13 out of 16 tomato F1 hybrids are resistant to cladosporiosis, and 12 of them have only Cf-9 alleles, 1 hybrid has both Cf-9 and 9DC resistance alleles in the genotype. Dominant homozygotes for the Cf-9 gene will be used in breeding programs of Poisk Agrofirm to create donor lines for resistance to cladosporiosis.

Исследования выполнены в 2021–2022 годах в ФГБНУ «Всероссийский научно-исследовательский институт сельскохозяйственной биотехнологии» (г. Москва). В ходе работы был проведён скрининг коллекции из 26 образцов яровой гексаплоидной тритикале и яровой пшеницы с помощью классической ПЦР и SDS-PAGE с целью разработки новых эффективных молекулярно-генетических маркеров для идентификации аллелей генов высокомолекулярных глютенинов (локусы Glu-А1 и Glu-B1). Исследование амфидиплоидной культуры тритикале, объединяющей геномы пшеницы и ржи, биоинформатический поиск новых аллельных вариантов, кодирующих глютенины, открывает огромные возможности для работы с новыми маркерами этих генов и установления взаимосвязей между ними и показателями качества зерна. Содержание белка определяет питательную и кормовую ценность зерна и продуктов его переработки, а также технологические свойства зерновой массы. Белок тритикале характеризуется хорошо сбалансированным аминокислотным составом, занимая промежуточное положение между белками пшеницы и ржи по содержанию аспарагиновой кислоты, треонина, аланина, валина и тирозина. Идентификация субъединиц глютенинов и секалинов тритикале сопряжена с определёнными трудностями, так как они присутствуют в разных соотношениях и имеют сходную электрофоретическую подвижность. Молекулярный метод идентификации во многих случаях является более информативным, применяется в том числе и для характеристики генотипов тритикале по технологическим качествам зерна. Целью исследования была идентификация генов, кодирующих определённые субъединицы высокомолекулярных глютенинов (аллелей локусов Glu-A1 и Glu-B1) у сортов и сортообразцов тритикале, с помощью разработанных праймеров. В исследуемой коллекции сравнивали комбинации субъединиц высокомолекулярных глютенинов, определённые на основе ПЦР-маркирования и SDS-PAGE. В статье были идентифицированы наиболее перспективные с селекционной точки зрения образцы яровой тритикале. Применение методов SDS-PAGE, ПЦР-маркирование в сочетании с определением качественных показателей зерна тритикале позволило провести оценку генотипов по технологическим параметрам. This investigation took place at the All-Russia Research Institute of Agricultural Biotechnology (Moscow) in 2021–2022. Twenty-six genotypes of spring hexaploid triticale and wheat were analyzed via PCR and SDS-PAGE to design new effective genetic markers identifying the alleles of high molecular weight (HMW) glutenin genes (Glu-А1 and Glu-B1 loci). Triticale as an amphidiploid crop comprising both wheat and rye genomes reveals new bioinformatic insights into finding new glutenin-coding alleles and correlations between genetic markers and grain quality. Protein content defines the nutritional and forage values of grain and grain products as well as the technological properties of grain mass. Triticale protein has balanced amino acid composition. In aspartic acid, threonine, alanine, valine and tyrosine it stands between the proteins of wheat and rye. The identification of triticale glutenin and secalin subunits has its pitfalls since these proteins are presented in various ratios and have similar electrophoretic mobility. Molecular identification is more efficient method and can be used to distinguish triticale genotypes according to the technological properties of their grain. The aim of this research was to identify genes coding HMW glutenin subunits (alleles of the Glu-A1 and Glu-B1 loci) of triticale genotypes using the primers designed. The combinations of HMW glutenin subunits were compared that were identified via PCR and SDS-PAGE. This article reports on the most promising genotypes of spring triticale to be used in breeding projects. SDS-PAGE and PCR together with the traits of grain quality enabled the genotype testing by technological properties.