Babaco (Vasconcellea × heilbornii) is a subtropical species in the Caricaceae family. The plant is native to Ecuador and represents an important crop for hundreds of families. The objective of this study was to characterize, at the genomic level, two new babaco viruses identified by high-throughput sequencing. The viruses, an ilarvirus and a nucleorhabdovirus, were found in a symptomatic babaco plant from a commercial nursery in the Azuay province of Ecuador. The tripartite genome of the new ilarvirus, provisionally named babaco ilarvirus 1 (BabIV-1), is related to subgroup 3 ilarviruses, including apple mosaic virus, apple necrotic mosaic virus, and prunus necrotic ringspot virus as the closest relatives. The genome of the nucleorhabdovirus, provisionally named babaco nucleorhabdovirus 1 (BabRV-1), showed the closest relation with joa yellow blotch-associated virus and potato yellow dwarf nucleorhabdovirus. Molecular-based detection methods found BabIV-1 and BabRV-1 in 21% and 36%, respectively, of plants surveyed in a commercial babaco nursery, highlighting the importance of enforcing virus testing and nursery certification programs for babaco.

Alfalfa (Medicago sativa L.) is a commonly grown forage crop in Oregon and California harvested on 350,000 and 480,000 acres, respectively, in 2023 (USDA-NASS 2023). Forage alfalfa is grown as a perennial crop for about four years in the same field and each season, the crop is cut 3-4 times for hay production. Consequently, each plant is exposed to a variety of biotic stresses including virus infections, with pathogens accumulating in the crop over years. Alfalfa was recognized in the past as a reservoir of legume viruses posing threats to peas and other legumes in the Pacific Northwest (PNW) of the United States (Hampton and Weber 1983; Kaiser et al. 1993). The most common viruses found in alfalfa in PNW are aphid-transmitted alfalfa mosaic virus (AMV), bean leafroll virus (BLRV), and pea streak virus (PeSV) (Hampton and Weber 1983; Kaiser et al. 1993; Larsen 2015; Dahan et al. 2022; Postnikova et al. 2023). Recently, a new virus, Snake River alfalfa virus (SRAV) was described from alfalfa in Idaho (Dahan et al. 2022), in Washington (Postnikova et al. 2023), and in Europe (Meseguer et al. 2024). Within PNW, surveys of alfalfa viruses in Oregon were not conducted for the past 30 years, and to fill in this knowledge gap on alfalfa viruses in the State of Oregon, a survey was initiated in the summer 2023. One-hundred thirty-nine leaf samples were collected from 13 alfalfa fields across Oregon, from four fields in Southern Idaho, and from four fields in Northern California between July 15 to September 5, 2023. Five to seven individual samples per field, exhibiting various virus-like symptoms, such as mosaic, chlorotic spots, leaf deformations, and yellowing, were collected randomly, placed in paper bags and shipped to the laboratory at the University of Idaho. Total nucleic acids were extracted from leaf tissue within 3-5 days after the field collections using the Dellaporta methodology (Dellaporta et al. 1983). Reverse transcription (RT) PCR was conducted according to the previously described protocol with specific primers for AMV, BLRV, and SRAV described by Dahan et al. (2022). For PeSV detection, two specific primers, PeSV_2F: TCACTGGATCATGGCYTTTG and PeSV_2R: AACCTTGAATCCTGACGCAA were designed and used in RT-PCR. In virus-positive samples, PCR fragments were treated with Exosap-It (Thermo Fisher Scientific, Waltham, MA), submitted for Sanger sequencing to Elim Biopharmaceuticals, Inc. (Hayward, CA), and confirmed to be virus-specific. The partial sequences of the alfalfa viruses found in Oregon, Idaho, and California were deposited in GenBank under the accession numbers PQ451070 to PQ451075 (PeSV), PQ451076 to PQ451087 (BLRV), PQ451088 to PQ451108 (AMV), and PQ467775 to PQ467806 (SRAV). Out of 139 samples tested, 61 were AMV-positive, 51 were BLRV-positive, 81 were SRAV-positive, and 6 were PeSV-positive. In-field prevalence varied between the four viruses, ranging for PeSV from 0% (1 field in CA, 4 fields in ID, and 8 fields in OR) to 43% (1 field in CA); for BLRV from 0% (2 fields in CA, 2 fields in ID, and 3 fields in OR) to 100% (2 fields in CA); for AMV from 0% (2 fields in CA and 4 fields in ID) to 100% (1 field in OR); for SRAV from 0% (2 fields in CA) to 100% (1 field in OR). Multiple samples had mixed infections of 2, 3, and even 4 viruses (1 sample from CA and 1 sample from OR). The role of each of these viruses in observed alfalfa virus-like symptoms and in an overall effect on productivity awaits further investigation. While SRAV was found before in alfalfa fields in Idaho (Dahan et al. 2022) and Washington (Postnikova et al. 2023), this is the first report of the virus presence in alfalfa crops in Oregon and in Northern California.

A new negative-strand RNA virus was identified in grapevines from a 38-year-old ‘Chardonnay’ block in Idaho through high-throughput sequencing (HTS) of total RNA. This virus was tentatively named grapevine-associated cogu-like Idaho virus (GaCLIdV). GaCLIdV has three negative-sense, single-stranded RNA genome segments of ca. 7 kb, 1.9 kb, and 1.3 kb, encoding L protein (RNA-dependent RNA polymerase, RdRP), a movement protein (MP), and a nucleocapsid protein (NC), respectively, identified based on pair-wise comparisons with other cogu- and cogu-like viruses. In phylogenetic analysis based on the RdRP, GaCLIdV grouped within the family Phenuiviridae and was placed in a lineage of plant-infecting phenuiviruses as a sister clade of the genus Laulavirus, clustering most closely with switchgrass phenui-like virus 1 (SgPLV-1) and more distantly related to grapevine-associated cogu-like viruses from the Laulavirus and Coguvirus clades. Both GaCLIdV and SgPhLV-1 are proposed to form a new genus, Switvirus, within the family Phenuiviridae. The presence of GaCLIdV in the original ‘Chardonnay’ samples was confirmed by RT-PCR amplification and Sanger sequencing. This new virus was found in five wine grape cultivars and in six vineyards sampled in Idaho and in Oregon during the 2020–2024 seasons. GaCLIdV may have contributed to the decline observed in the old ‘Chardonnay’ block, although the role of the virus in symptom development awaits further investigation.

A novel barna-like virus was found to be associated with field-collected Afrina sporoboliae plant-parasitic nematodes. The positive-sense, single-stranded RNA genome of this virus, named Afrina barna-like virus (AfBLV), comprises 4020 nucleotides encoding four open reading frames (ORFs). ORF 1 encodes a protein product spanning a transmembrane, a peptidase, and VPg domains, whereas an overlapping ORF 2 encodes an RNA-dependent RNA polymerase (RdRP). ORF2 may be expressed via a −1 translational frameshift. In phylogenetic reconstructions, the RdRP of AfBLV was placed inside a separate clade of barna and barna-like viruses related to but distinct from the genera in the Solemoviridae and Alvernaviridae families, within the overall lineage of Sobelivirales. ORF 3 of AfBLV encodes a protein product of 206 amino acids (aa) long with homology to a putative protein encoded by a similarly positioned gene of an uncharacterized virus sequence identified previously as Barnaviridae sp. ORF 4 encodes a 161 aa protein with no significant similarities to sequences in the GenBank databases. AfBLV is the first barnavirus found in a nematode. Sequence comparisons of the AfBLV genome and genomes of other barna-like viruses suggested that a recombination event was involved in the evolution of AfBLV. Analyses of the phylogeny of RdRPs and genome organizations of barna-like and solemo-like viruses support the re-classification of Barnavirus and Dinornavirus genera as members of the Solemoviridae family.

Pea streak virus (PeSV) is an aphid-transmitted virus infecting a broad range of legumes, including alfalfa and cool season food legumes such as chickpeas, lentils, and peas. The diseases caused by PeSV in cool season food legumes were studied in the Pacific Northwest (PNW) of the U.S. in the past, prior to the availability of molecular tools and currently the genetic diversity of PeSV in the PNW is largely unknown. To fill in this knowledge gap and evaluate risks posed by main genetic variants of PeSV circulating in the PNW pulses, an isolate of PeSV was collected from alfalfa in Idaho and subjected to molecular and biological characterization on several major cool-season food legume species grown in the PNW, including chickpeas, lentils, and peas. This Idaho isolate of PeSV, PeSV-Id, induced severe necrotic symptoms in chickpeas, lentils, and dry peas, with a high rate of mortality reaching 100% in some chickpea lines. The virus was purified and used as an antigen for production of PeSV-specific antibodies, and development of a sensitive ELISA assay. Phylogenetically, PeSV-Id belonged to a tight lineage of North American isolates of the virus, distinct from the alfalfa latent virus strain of PeSV. The virus was easily transmitted mechanically under greenhouse conditions and was found to spread quickly in alfalfa in the field in the span of 3 to 52 months post-planting. Based on the data obtained, PeSV should be considered a potential threat to the production of pulse crops growing in the vicinity of alfalfa.