Maize chlorotic mottle virus (MCMV) is the only species in the genus Machlomovirus family Tombusviridae and maize is the only natural host. Hosts that can be infected experimentally by MCMV are limited to the grasses in the family Poaceae (Scheets, 2004). In 2011, MCMV was first reported in maize plants in Yunnan Province (Xie et al.2011) and it has been found to infect sugarcane (Saccharum officinarum L.) in the same region (Wang et al.2014). In August 2014, while surveying MCMV on maize in Yunnan Province, we found chlorotic and mosaic viral symptoms on sorghum (Sorghum bicolor L.Conrad Moench) and coix seed (Coix chinensis Tod. ) that were planted near an MCMV-infected maize field in Yuanjiang county. Five symptomatic sorghum and coix seed plants were collected and analyzed by DAS – ELISA using a Maize chlorotic mottle virus ELISA Kit (Creative Diagnostics, US), All disease samples reacted positively with the antibody for Maize chlorotic mottle virus(MCMV)．The positive samples were further analyzed for MCMV by reverse transcription (RT)-PCR with primers MCMV-F（CCCGAGGTAGAAAGCAGC）and MCMV-R(AGGCCAGTTTGTAGGATTGTTG), were designed on the basis of reported sequences (GU138674, AM490791-3, AY587605) used for the detection of MCMV CP gene. The expected 711-bp fragment was obtained from all plant samples. The sequence (Accession number: KP203016) of the amplified products from sorghum and sequence (Accession number: KP203017) from coix seed, both shared 98% similarity with the MCMV sequence (JQ982470) obtained from maize. Therefore, we determined the sorghum and coix seed plants exhibiting chlorotic and mosaic symptoms were infected by MCMV. The present study indicated that MCMV can naturally infect sorghum and coix seed plants. To our knowledge, this is the first report of MCMV natutrally infecting these two crops in China. (1) Scheets, K. 2004. Maize chlorotic mottle. In: H. Lapierre and P.-A. Signoret (eds.) Viruses and virus diseases of Poaceae (Gramineae). Institut National de la Recherche Agronomique, Paris. (2) Xie, Li., Zhang, J.Z., Wang, Q., Meng,C.M., Hong J., and Zhou,X.P.2011. Characterization of Maize Chlorotic Mottle Virus Associated with Maize Lethal Necrosis Disease in China. J Phytopathol 159:191–193 (2011) (3) Wang, Q., Zhou, X. P., and Wu, J. X. 2014. First report of Maize chlorotic mottle virus infecting sugarcane (Saccharum officinarum). Plant Dis.98:572. Acknowledgement: This work was funded by the Yunnan Maize Production System, China.

The quarantine pest, Cylas formicarius, is a key pest of sweet potatoes during both production and storage, posing a major threat to food security in various countries. To investigate behavioral mechanisms, the ultrastructure of the heads of larval and adult stages was analyzed using scanning electron microscopy, with an emphasis on the sensilla of the mouthparts and antennae. The results reveal degeneration of the antennae and ocelli in larvae. The larval mouthparts are equipped with three types and six subtypes of sensilla. Both male and female adults have four types and six subtypes of sensilla on their mouthparts. Compared to larvae, the adult mouthparts display a greater diversity of sensilla types and higher numbers of sensilla basicaonica (SB), sensilla chaetica (SC), and sensilla digitiformia (SD). Adult antennae consist of a scape, a pedicel, and eight flagellomeres (F1–F8), with F8 showing sexual dimorphism. Seven types of sensilla, excluding SB and sensilla ligulate (SL), each with two subtypes, were identified on the antennae of adults of both sexes. SC, sensilla furcatea, Böhm bristles, and SL were newly observed in the antennae of C. formicarius adults. Additionally, one type and seven subtypes of sensilla on the adult antennae exhibit distinct sexual dimorphism in terms of structure or number. The relationship between the head structure and adaptability of C. formicarius was examined, and the functions of each sensilla were discussed, providing a theoretical basis for future studies on the behavior of this pest.