The 16SrIV-A phytoplasmas are associated with the devastating disease lethal yellowing (LY) of palms. In Tabasco (Mexico), the death of Cocos nucifera, Adonidia merrillii, and Attalea butyracea palms have been suspected to be associated with LY based on symptomatology. Samples from the trunk of both symptomatic and nonsymptomatic palms were collected in three different environments: two species of palms within a rural zone and the other within an urban zone. DNA was extracted to perform a nested PCR with phytoplasma primers P1/P7-LY16SF/R16R2. A 1,345-bp fragment was amplified from the DNA extracted from each of the 29 LY-symptomatic palms sampled. Phytoplasma identification was achieved by amplicon sequencing and virtual restriction fragment length polymorphism analyses. Three 16SrIV phytoplasma subgroups were detected: 16SrIV-A in C. nucifera, 16SrIV-B in A. merrillii, and 16SrIV-D in C. nucifera, A. merrillii, and A. butyracea. Phylogenetic analysis showed also that the three phytoplasma strains found in the palm species clustered with phytoplasmas reported in the literature in the three subgroups identified. This is the first report of phytoplasmas associated with these palm species in Tabasco.

Annona muricata is an important and widespread neotropical perennial fruit tree, that has received increasing attention in recent years for its pharmaceutical potential, particularly for the presence of metabolites with reported anti-tumoral properties. In this study, 191 samples of this species were collected from homegardens across four states of southern Mexico. and analyzed using a dual approach, including genetic and chemical analyses. The local genetic diversity and population structure was determined through the analysis of 10 microsatellite loci- The metabolic content of flavonoids and polyphenols was analyzed at ten localities. Genetic diversity was found to be low to moderate in all populations with values of expected heterozygosity (H_e) ranging from 0.28 to 0.52. Our research indicated the presence of three distinct genetic groups, which did not appear to be associated with geographical origin. Variations in the chemical content of flavonoids and polyphenols were observed among the different locations examined, with flavonoid values ranging between 73.48 and 592.70 mg RE/gE and polyphenol values ranging from 13.10 to 126.59 mg GAE/gE. Accessions from Champoton and Emiliano Zapata demonstrated the highest flavonoid content, while Palenque, Champoton and Centro presented the highest polyphenol content. Multidimensional scaling (MDS) analysis revealed a correlation between genetic profiles, chemical profiles and the influence of human activity in the populations examined. This analysis revealed significant genetic differences between these populations, suggesting that they are associated with different levels of chemical contents. Remarkably, highly disturbed sites appeared to correlate with a considerable increase in chemical content.

Antillean manatees ( Trichechus manatus manatus), a subspecies of the West Indian manatee, is listed as endangered species in the Red List of Threatened Species of the International Union for Conservation of Nature. The aims of this research were to survey on the possible regional genetic structure in the southern Gulf of Mexico and to compare genetic status of a landlocked population in Laguna de las Ilusiones (IL) with individuals from localities with no barriers to displacement and breed (open population [OP]). We analyzed 45 manatee skin samples collected from different locations in Tabasco ( n = 38, including 19 from IL), Veracruz ( n = 3), Campeche ( n = 2), and Chiapas ( n = 2). The genomic DNA was isolated and PCR amplifications were performed for each sample using 28 microsatellite loci, previously designed for West Indian manatees and described as polymorphic for this species. Two clusters ( k = 2) were identified by STRUCTURE. The analysis of both a priori populations (IL and OP) indicate that the global values of F_ST and R_ST ( F_ST=0.049, R_ST=0.077) were significant. The H_E for IL was 0.38 ± 0.03 and for OP was 0.49 ± 0.01. The average number of alleles N_A for IL was 2.21 ± 0.09 and for OP was 2.32 ± 0.09. The overall inbreeding coefficient was F_IS=−0.013 for analyzed populations. Genetic diversity was low. The IL population had slightly lower genetic diversity compared with OP, which could be explained by isolation of that small group, so conservation plans for IL should be considered as priority.

The Meso-American slider turtle ( Trachemys venusta) is a freshwater turtle that is widely distributed from Mexico to Colombia. Due to the overexploitation of populations of this species in Mexico, it has been placed within the “subject to special protection” category formulated by the Official Mexican Standard NOM-059-ECOL-2010. In the state of Tabasco, Mexico, Management Units for the Conservation of Wildlife (UMA) were created to reduce the impact of overexploitation of freshwater turtles bred in captivity. However, no genetic management plan was considered. The present study was carried out in an UMA in the state of Tabasco. We obtained the level of genetic diversity of the founder individuals of the UMA in order to develop a management plan which will optimize reproduction in the UMA. Genetic diversity was compared between captive (n = 86) and wild (n = 45) individuals using 14 microsatellite molecular markers. The genetic diversity parameter ​​determined in this study was slightly higher for captive than for wild population ( H_e = 0.606 and H_e = 0.594 respectively), reflecting the mix of genetic sources in captive group (founding individuals from different localities) and demonstrating that the captive population contains a diverse subset of alleles from representative populations. The analysis of genetic structure revealed a relationship between captive and wild populations, indicating the influence of the two principal river basins in this region on the populations structure of freshwater turtles. Finally, according to the results obtained from the relationship analysis, we recommend the use of 19 females and 13 males to constitute the appropriate breeding group, generating a potential of 247 dyads with no relationship. However, in order to improve breeding program and the genetic diversity of captive population, we suggest to introduce wild-caught individuals. These results are the first regarding genetic management in a Mexican UMA and demonstrate the importance of molecular approaches in the management and conservation of captive species.

The phytoplasmas of the 16SrIV group cause lethal yellowing diseases (STAL) in palms worldwide. The Phytoplasma of coconut lethal yellowing (LY) has been known as 'Candidatus Phytoplasma palmae' (16SrIV-A). Like LY, many diseases caused by phytoplasma worldwide, their vectors have not been identified. The only incriminated phytoplasma vector of the LY is Haplaxius crudus (Hemiptera: Cixiidae). The objective of the present study was to determine the presence of 16SrIV phytoplasma in cixiids and derbids associated with palms (Adonidia merrillii y Cocos nucifera) positive to phytoplasmas. Captures of insects associated with these palms were made during the morning and afternoon. The presence of phytoplasma was determined by the real-time PCR using the TaqMan LY16S-ANYF (GCTAAGTCCCCACCATAACGT) and LY16S-ANYR (CGTGTCGTGAGAT-GTTAGGTTAAGT) primers; probe LY16S-ANYM (FAMCCCCTGTCGTTAATTG-NFQ). The presence of phytoplasma of the 16SrIV group was not detected in H. crudus although its presence was shown in H. skarphion (Hemiptera: Cixiidae), Oecleus snowi (Hemiptera: Cixiidae) and Persis foveatis (Hemiptera: Derbidae). These results suggest that these three species may be potential vectors of phytoplasma of group 16 SrIV in palms.

Annona reticulata is an important native American species recognized since pre-Columbian times. Although rarely cultivated, it has become a major source of natural medicine, among other applications of global importance. To obtain general and up-to-date information on the different aspects of this species, a comprehensive bibliographic review was conducted using digital sources such as Web of Science and Google Scholar, as well as reviews in physical and virtual herbaria to obtain georeferenced data and determine their current and potential eco-geographic distribution (Global Biodiversity Information Facility, Universidad Juárez Autónoma de Tabasco, Herbario Nacional de México, and Instituto de Ecología). The morphological varieties were identified and characterized through fruit collections in the Sierra Subregion, in Tabasco, Mexico. The literature review focused on the botanical description, anatomy, physiology, propagation, and associated diseases and pests of the plant, as well as its economic importance. High-level information was recorded regarding phytochemical aspects and application in medicine outside Mexico. It was determined that there is little specific data on the plant's anatomy, physiology, and post-harvest physiological factors. Moreover, in some topics, the existing information is obsolete: this is the case for themes of agronomic and phytosanitary management, as well as studies of phylogenetics and molecular markers for conservation and breeding. Its status as a native species suggests a need for conservation. However, for preservation in germplasm banks, it is essential to determine the plant tolerance to desiccation and low temperatures.