Livestock especially cattle are known as a main reservoir ofEscherichia coliO157:H7. This bacterium is considered as a pathogenic agent characterized by producing toxins, which are familiarly known as Shiga-like toxin-1 (Stx1) and Stx2. The aim of this work was to analyse the novel sequence of the 16S rRNA gene of strains isolated in this study in order to know the phylogenetic relationships between these sequences and those between the sequences of bacteria available in databanks. The results of this analysis showed that the strains KL-48(2) and SM25(1) that originated from human and cattle feces, respectively, are closely related among them and with respect toE. coliEDL 933,E. coliSakai,E. coliATCC 43894,E. coliO111:H-,E. coliO121:H19,E. coliO104:H4, andShigella sonneiwith more than 99% similarity values.

Indonesia has many areas with the various tourism potentials but faces obstacles in the management, one of them is Suranadi Tourism Village in Narmada District, West Lombok Regency. This research aimed to analyze 1) the potential and tourism management system in Suranadi Tourism Village; 2) internal and external factors affecting the development of Suranadi Tourism Village; 3) the development strategy of Suranadi Tourism Village. This research applies some theories such as tourism destination development theory by Cooper (1993), irridex theory by Doxey (1976), and tripartite attraction design theory by Gunn (1972). This research used qualitative approach with descriptive method. Data obtained through interviews and observation. The method of data analysis in this research is by qualitative data analysis and SWOT analysis. The results showed that the potential of Suranadi Village as a cultural tourism village that is the potential of nature and culture. The various of potentials in the Suranadi Tourism Village as a whole has not managed professionally and optimally so that economic benefits are not fully felt for local community. The results of SWOT matrix analysis showed that there are four alternative strategies generated such as SO strategy (Strengths-Opportunities), ST strategy (Strengths-Threats), WO strategy (Weaknesses-Opportunities), WT strategy (Weaknesses-Threats). Keywords: tourism potential, development strategy, Suranadi Tourism Village, SWOT

Aim: This study aimed to determine the effect of the bacteriocin produced by strain 9 lactic acid bacteria (LAB) isolate on the biopreservation of beef. Materials and Methods: The strain 9 LAB isolate was identified conventionally by culturing with de Man, Rogosa, and Sharpe broth medium followed by Gram staining and catalase testing. The molecular confirmation of the isolate involved analyzing the 16S rRNA gene with specific primers, that is, B27F (5-AGAGTTTGATCCTGGCTCAG-3) and U1492R (5-GGTTACCTTGTTACGACTT-3). Then, the isolate was centrifuged to evaluate the bacteriocin production, and the effect of the biopreservative activity in beef was evaluated by measuring the NH3 produced with the Eber test and the organoleptic acceptance from expert panels. Results: This study confirmed that the strain 9 LAB isolate was a strain of Pediococcus pentosaceus, and the bacteriocin product showed biopreservative potential. The biopreservative potential was characterized by a significant decline in the production of NH3 and the panel's acceptance of the texture and tenderness of the beef, compared with the control, after 10 days of constant treatment. Conclusion: This study highlighted the high biopreservative potency of pediocin produced by P. pentosaceus strain 9. This was noted by the production of NH3 and the modifications in texture and tenderness.

Background and Aim: Meatballs are a processed product of animal origin that is consumed cooked, usually with chicken, beef, or pork as the main ingredient. Unfortunately, some unscrupulous sellers in Indonesia may adulterate this product with rat meat to decrease production costs. Rat meat in any food is a critical public health issue and is prohibited under Indonesian food safety laws, as well as within Muslim communities. This study aimed to test the sensitivity of the polymerase chain reaction (PCR) method in the detection of rat meat contained in processed, cooked beef meatballs. Materials and Methods: Beef meatballs were formulated with different concentrations of rat meat. Molecular detection of adulteration was initiated by DNA extraction of each cooked meatball formulation followed by PCR using a specific primer for mitochondrial DNA Cytochrome b gene of rat, which primer sequences, i.e., forward primer: 5'CATGGGGACGAGGACTATACTATG '3 and reverse primer: 5'GTAGTCCCAATGTAAGGGATAGCTG'3. Results: Our study showed that the PCR method is sensitive in detecting 5% or greater rat meat adulteration of cooked beef meatballs. Conclusion: The PCR method can be used to detect most rat meat adulteration of cooked beef meatballs and offers a sensitive and effective means to protect food safety and religious requirements in Indonesia.

Shiga-like toxin (Stx) is an important factor in the pathogenesis of Escherichia coli O157:H7 infection and is responsible for some severe complications. Stx2 is usually associated with hemolytic uremic syndrome in humans. Its expression is regulated by elements located upstream of the stx2 gene, including stx2-promoter sequence, ribosome binding site, and the antiterminator q gene. The present study aimed to find the correlation between regulatory elements and the expression level of Stx2 in two local isolates of E. coli O157:H7. Two local E. coli O157:H7 strains SM-25(1) and KL-48(2), originating from human and cattle feces, respectively, and an E. coli reference strain, ATCC 43894, were investigated. The complete stx2 gene covering the sequences of promoter, ribosome binding site, and open reading frame and q gene of each strain was analyzed. The magnitude of Stx2 production was detected with a reverse passive latex agglutination method and Stx mediated cellular damage was determined with the Vero cell assay. A comparison of the complete stx2 gene contained stx2-promoter, ribosome binding site, and q genes of two local strains KL-48(2) and SM25(1), and the E. coli ATCC 43894 showed that the amino acid sequences were identical. Both local isolates were Stx negative in the reverse passive latex agglutination test and nontoxic in the Vero cell assay. The expression level of Shiga-like toxin of the two local isolates of E. coli O157:H7 did not only depend on the regulatory elements of the stx2 gene.