Mitogenome sequences have a high potential for possessing single-nucleotide polymorphisms (SNPs) that can be used to identify different strains of an organism bred based on maternal lines. The European honey bee, Apis mellifera ligustica (Hymenoptera: Apidae), with a high-hygienic behaviour (HHB) against the external parasitic mite Varroa destructor has been bred for several years in Korea. To distinguish this strain from low-hygienic behaviour (LHB) strains, the complete mitogenome of the two strains were sequenced using next-generation sequencing techniques to detect SNPs. The two mitogenomes with lengths of 16,449 and 16,426 base pairs (bp) in the HHB and LHB strains, respectively, contained a typical set of genes (13 protein-coding genes, 2 rRNA genes, and 22 tRNA genes, plus one non-coding region), exhibited similar-nucleotide compositions, and had an identical gene arrangement compared to other available A. mellifera mitogenomes. The major differences between the HHB and LHB strains included the length of the intergenic spacer sequences located at the COIII and trnG junction (88 vs. 70 bp) and ND4 and ND4L junction (45 vs. 33 bp) and the presence or absence of a duplicated sequence block (CTTTTTTAAAAAAATAAAAA) in the A + T-rich region. Comparison of the mitogenome sequences from the two strains of A. m. ligustica revealed 23 SNPs in 11 protein-coding genes which were confirmed by sequencing of 10 randomly selected individuals from each strain, indicating the usefulness of these SNP markers for identifying the HHB strain of A. m. ligustica. Therefore, mitogenome sequences are a promising genome source for detecting SNP markers, particularly those in inbred female lines.

The clinical course and medical treatment of patients with congestive heart failure (CHF) complicating acute myocardial infarction (AMI) are not well established, especially in patients with concomitant renal dysfunction. We performed a retrospective analysis of the prospective Korean Acute Myocardial Infarction Registry to assess the medical treatments and clinical outcomes of patients with CHF (Killip classes II or III) complicated by AMI, in the presence or absence of renal dysfunction. Of 13,498 patients with AMI, 2769 (20.5%) had CHF on admission. Compared to CHF patients with preserved renal function, in-hospital mortality and major adverse cardiac events were increased both at 1 month and at 1 year after discharge in patients with renal dysfunction (1154; 41.7%). Postdischarge use of aspirin, betablockers, calcium channel blockers, angiotensin-converting enzyme inhibitors, or angiotensin II receptor blockers and statins significantly reduced the 1-year mortality rate for CHF patients with renal dysfunction; such reduction was not observed for those without renal dysfunction, except in the case of aspirin. Patients with CHF complicating AMI, which is accompanied by renal dysfunction, are at higher risk for adverse cardiovascular outcomes than patients without renal dysfunction. However, they receive fewer medications proven to reduce mortality rates.

As the resolution and accuracy of diagnostic techniques for preimplantation genetic testing for aneuploidy (PGT-A) are improving, more mosaic embryos are being identified. Several studies have provided evidence that mosaic embryos have reproductive potential for implantation and healthy live birth. Notably, mosaic embryos with less than 50% aneuploidy have yielded a live birth rate similar to euploid embryos. This concept has led to a major shift in current PGT-A practice, but further evidence and theoretically relevant data are required. Proper guidelines for selecting mosaic embryos suitable for transfer will reduce the number of discarded embryos and increase the chances of successful embryo transfer. We present an updated review of clinical outcomes and practice recommendations for the transfer of mosaic embryos using PGT-A.

We report a case of Serratia marcescens peritonitis in a 45-year-old man with insulin-dependent diabetes mellitus undergoing continuous ambulatory peritoneal dialysis (CAPD). The patient presented with abdominal pain and cloudy dialysate. Empiric antibiotic therapy was initiated intraperitoneally with cefazolin and ceftazidime for 5 days. Cultures of the dialysate revealed S. marcescens, and the treatment was subsequently changed to gentamicin and ceftazidime. Oral ciprofloxacin was also added. The patient's abdominal pain and the dialysate white blood cell (WBC) count, however, did not improve. The indwelling CAPD catheter was therefore removed. This is an unusual case report in the Korean literature of S. marcescens peritonitis in a patient receiving CAPD.

Min Jee Kim, Sun Ok Park, Ye Seul Hong, Eun A Park, Yu Bin Lee, Byung-Ok Choi, Kyung-Ah Lee, Eun Jeong Yu, and Inn Soo Kang. J Genet Med 2022;19:7-13. https://doi.org/10.5734/JGM.2022.19.1.7

Background: Charcot–Marie–Tooth disease (CMT) is a genetically and clinically heterogeneous group of progressive peripheral neuropathies. Preimplantation genetic testing for monogenic disorders (PGT-M), a well-established assisted reproductive technology used to detect specific genetic mutations in embryos before implantation, has been used in common CMT subtypes (e.g., CMT1A); however, data on its application across rarer subtypes and in de novo cases remain limited. In this study, we aimed to evaluate the effectiveness of PGT-M using karyomapping in achieving clinical pregnancies and healthy births in families affected by various CMT types, including the previously unreported subtypes CMT1B and CMT2. Methods: We analyzed 31 PGT-M cycles from 13 families with genetically confirmed CMT, including cases of previously unreported subtypes CMT1B and CMT2. A total of 150 embryos were biopsied. Through 19 embryo transfer cycles, 21 embryos were transferred. In one de novo case, karyomapping was performed using amniotic fluid from an affected fetus as a reference. Results: Of the 19 embryo transfers, 15 resulted in clinical pregnancies. Prenatal diagnosis confirmed that all fetuses were unaffected, and all pregnancies resulted in healthy live births. Successful phasing using amniotic fluid from an affected fetus enabled accurate embryo selection and led to the birth of healthy twins. Conclusions: PGT-M using karyomapping is a rapid and reliable method for achieving successful pregnancies in families affected by diverse CMT subtypes, including de novo cases, and supports broader applicability to other monogenic disorders.