Rose is considered one of the most important cut flowers in China. Viral diseases significantly impact plant vigor, flower quality and production yield (Milleza et al., 2013). Apple stem grooving virus (ASGV) was recently identified to infect wild rose (Rosa multiflora) (He et al., 2015). It is unknown if ASGV can infect other rose species. Total of eight asymptomatic and seven symptomatic (showing rosette leaf) samples of R. rugosa (6 samples), R. chinensis grown on their roots (4) and R. multiflora (5), were collected from Wuhan, Hubei province, China. Total RNA was extracted from these 15 samples with a previous method (Carra et al., 2007) and subjected to RT-PCR using the primer pairs [ASGV-499-1 5ˊ- CCCGCTGTTGGATTTGATACACCTC-3ˊ/ASGV-499-2 5ˊ- GGAATTTCACACGACTCCTAACCCTCC -3ˊ (He et al. 2015) and ASGV-CP-F 5ˊ- GAGTTTGGAAGACGTGCTTCAACAAGCG-3ˊ/ASGV-CP-R 5ˊ- CCTAACCCTCCAGTTCCAGGTTACTCTCC-3ˊ used to amplify partial and full-length of the coat protein (CP) gene, respectively]. The results indicated that thr...

Soluble sugars are key determinants of fruit quality, directly influencing sensory attributes such as sweetness and flavor, as well as nutritional value and texture. Their content and composition are precisely regulated by sugar-metabolizing enzymes. Key enzymes, including invertase (INV), sucrose phosphate synthase (SPS), sucrose synthase (SUS), fructokinase (FRK), and hexokinase (HXK), play pivotal roles in these processes. However, a systematic and in-depth analysis of their regulatory mechanisms is currently lacking, which hinders a comprehensive understanding of the regulatory network governing fruit sugar metabolism. This review employs bibliometric analysis to systematically examine research trends in fruit sugar metabolism. Furthermore, it synthesizes recent advances in the coordinated regulatory mechanisms from the perspectives of transcriptional regulation, epigenetic modifications, and signal transduction, aiming to provide a clearer framework for future research. At the transcriptional level, transcription factor families such as MYB, WRKY, NAC, and MADS-box achieve precise regulation of sugar metabolism-related genes by specifically binding to the promoters of their target genes. Regarding epigenetic regulation, mechanisms including histone modifications, non-coding RNAs, and DNA methylation influence the expression of sugar-metabolizing enzymes at the post-transcriptional level by modulating chromatin accessibility or mRNA stability. Signaling pathways integrate hormonal signals (e.g., ABA, ethylene), environmental signals (e.g., temperature, light), and sugar-derived signals into the regulatory network, forming complex feedback mechanisms. These regulatory mechanisms not only directly affect sugar accumulation in fruits but also participate in fruit quality formation by modulating processes such as cell turgor pressure and carbon allocation. By integrating recent findings on transcriptional regulation, epigenetics, and signaling pathways, this review provides a theoretical foundation for fruit quality improvement and targeted breeding.

Bactrocera dorsalis is a serious pest of mango, causing heavy losses during fruit ripening. Odorant-binding proteins (OBPs) are pivotal in insect olfaction, facilitating the detection of host plant volatiles. In this study, we focused on OBPs that mediate responses to volatiles from the Guire No.82 mango. Quantitative real-time PCR showed cultivar-dependent expression of six antennal OBP genes. Among these, BdorOBP84a-1 was highly expressed in adults fed on Guire No.82. The 3D structure of BdorOBP84a-1 was predicted with AlphaFold3, showing six α-helices and three disulfide bonds forming a hydrophobic pocket. Molecular docking and 100-ns MD simulations indicated strong and stable binding of sesquiterpenes. Caryophyllene and ledene showed the lowest binding free energies (-31.87 and -30.62 kcal/mol) and stable RMSD/RMSF values. Key residues, including PHE95, ILE109 and PHE133, contributed to binding through hydrophobic and aromatic interactions. Y-tube behavioral assays validated these computational predictions. Caryophyllene attracted males at very low (0.01%) and high (10%) doses, females responded selectively at 0.1% and 1%, ledene attracted males at 0.1% and 10%, These findings suggest that BdorOBP84a-1 mediates recognition of mango sesquiterpenes and that caryophyllene and ledene are promising leads for new attractants in B. dorsalis management.

Postharvest anthracnose caused by Colletotrichum spp. remains a constraint to the storage and marketing of tropical and subtropical fruits. Edible antifungal coatings carrying biopolymers and antifungal agents have received considerable attention as alternatives to conventional fungicides. Previous research has demonstrated the potential of biopolymers, essential oils, biocontrol agents, nanoemulsions, Pickering emulsions, multilayer coatings, and delivery systems. However, strong inhibition of mycelial growth or conidial germination in vitro does not consistently translate into equivalent disease control on fruit, indicating that intrinsic antifungal potency alone is insufficient to explain postharvest performance. Colletotrichum conidia are initially exposed at the fruit surface, but appressorium formation, cuticle penetration, and quiescent colonization progressively separate the pathogen from surface-applied actives. Meanwhile, fruit cuticles vary among hosts and cultivars and continue changing during storage. Temperature, relative humidity, condensation, ripening, and handling further influence infection and coating properties, while active physicochemical processes determine antifungal retention, partitioning, volatilization, and release. This review examines and compares edible antifungal coatings through infection-site bioavailability, integrating pathogen stage, fruit-surface transport, storage trajectory, active properties, and coating architecture to explain the in vitro–to-in situ translation gap and define context-matched design and measurement priorities.