T. fasciatus (Takifugu fasciatus) faces the same problem as most warm water fish: the water temperature falls far below the optimal growth temperature in winter, causing a massive death of T. fasciatus and large economic losses. Understanding of the cold-tolerance mechanisms of this species is still limited. Integrated application of multi-omics research can provide a wealth of information to help us improve our understanding of low-temperature tolerance in fish. To gain a comprehensive and unbiased molecular understanding of cold-tolerance in T. fasciatus, we characterized mRNA-seq and metabolomics of T. fasciatus livers using Illumina HiSeq 2500 and UHPLC-Q-TOF MS. We identified 2544 up-regulated and 2622 down-regulated genes in the liver of T. fasciatus. A total of 40 differential metabolites were identified, including 9 down-regulated and 31 up-regulated metabolites. In combination with previous studies on proteomics, we have established an mRNA-protein-metabolite interaction network. There are 17 DEMs (differentially-expressed metabolites) and 14 DEGs-DEPs (differentially co-expressed genes and proteins) in the interaction network that are mainly involved in fatty acids metabolism, membrane transport, signal transduction, and DNA damage and defense. We then validated a number of genes in the interaction network by qRT-PCR. Additionally, a number of SNPs (single nucleotide polymorphisms) were revealed through the transcriptome data. These results provide key information for further understanding of the molecular mechanisms of T. fasciatus under cold stress. The data generated by integrated application of multi-omics can facilitate our understanding of the molecular mechanisms of fish response to low temperature stress. We have not only identified potential genes and SNPs involved in cold tolerance, but also show that some nutrient metabolites may be added to the diet to help the overwintering of T. fasciatus.

Understanding the molecular mechanism of melanogenesis in Plectropomus leopardus is important for exploring the pattern of skin colour variation in grouper. The research team conducted a combined transcriptomic and proteomic analysis of P. leopardus skin tissues in red-skinned and black-skinned fish and found that the common differences were reflected in the melanogenesis pathway. Therefore, to further investigate the molecular mechanism of melanogenesis in P. leopardus, the full-length sequences of the erk1/2 and mitf genes were obtained in this study using the RACE technique. Through structure-function analysis and differential expression in different red-skinned and black-skinned P. leopardus tissues, it was found that the MAPK signalling pathway may be involved in skin colour changes in P. leopardus, and when erk1/2 expression was decreased in P. leopardus, mitf expression increased accordingly. On the one hand, through short-term in vivo injection of erk1/2-dsRNA, the optimal interference primer for experimented fish was found to be group D: F2R1(F2: TAATACGACTCACTATAGGGATCAACGACATTCTCAGGGC; R1: TAATACGACTCACTATAGGGTCCATGGAGAAAGTGAAGGG), the optimal injection site was the tail vein, the optimal interference concentration was 5 µg/g, and the duration of the interference effect was 5 days. The results of long-term interference showed that when erk1/2 expression was decreased in P. leopardus, the skin colour of the treats fish then darkened, which indicated that ERK1/2 was involved in the regulation of melanogenesis. On the other hand, in vitro Co-Immunoprecipitation (Co-IP) results showed that there was a direct or indirect interaction between MITF and ERK1/2 proteins. In conclusion, this is the first time that an interaction between ERK1/2 and MITF, which indicated that ERK1/2 was involved in the regulation of melanogenesis through the regulation of MITF in P. leopardus. These results further enrich our understanding of the theoretical basis of the changing pattern of skin colour in P. leopardus and provides a new perspective for exploring the variable skin colouration of coral reef fish.

To explore the feeding regulatory mechanism of the leptin gene and its receptor, the full-length cDNA of Tbleptin-B and TbleptinR were cloned from Trachinotus blochii, and their expression patterns in different dietary strategies were analysed. The preprandial expressions of Tbleptin-A, Tbleptin-B and TbleptinR in liver showed a downward trend as a function of time. However, 1 h after postprandial, Tbleptin-A increased significantly, Tbleptin-B decreased significantly, TbleptinR did not change, and their postprandial expressions were not significantly different with the control group at 3 h. This result indicated that Tbleptin-A and Tbleptin-B were involved in the postprandial regulation of liver within 3 h. Similarly, the expressions of Tbleptin-A, Tbleptin-B and TbleptinR in liver were not different from the control group after refeeding (d11), which showed that the expressions of them in liver would return to normal level after long-term hungry golden pomfret getting enough food. In hypothalamus, the postprandial expressions of Tbleptin-B and TbleptinR were significantly increased at 1 h, while Tbleptin-A was inhibited. Similarly, after refeeding, the expression of Tbleptin-A was significantly lower than that of the control group, and Tbleptin-B was significantly higher than that of the control group. In summary, Tbleptin-A, Tbleptin-B and TbleptinR play different roles in coping with different dietary strategies in liver and hypothalamus. Tbleptin-A is mainly involved in dietary regulation through liver, while Tbleptin-B and TbleptinR are mainly active in the hypothalamus. These results provide valuable information to reveal the T. blochii feeding regulatory mechanism.

Despite the recognized involvement of TTC39 family genes in metabolism related to pigment deposition, their evolutionary features and potential roles in body coloration in teleost fish remain largely unexplored. We identified three TTC39 genes in Plectropomus leopardus, conserved domains, and evolutionary relationships. The three genes (TTC39A, TTC39B, and TTC39C) were mapped to different chromosomes, yet they shared similar conserved protein domains. Phylogenetic and collinearity analyses indicated that TTC39 genes are evolutionarily conserved among Danio rerio. Gene structure and motif analyses further highlighted the homology and distributional diversity within the TTC39 family. Quantitative expression assays comparing red and black skin revealed significant upregulation of TTC39A and TTC39B in red skin, suggesting that these genes play a role in regulating skin color. These findings provide a foundation for future studies examining how TTC39 genes regulate red skin coloration in P. leopardus.

The velocity of water can cause differences in the growth of inhabitant fish, thereby functioning as an important aquatic environmental factor. In order to explore the response mechanism of Leopard Coralgrouper (Plectropomus leopardus) under different flow velocities, P. leopardus fish of the same sizes were fed in water characterized by three different flow rates (5 cm/s, 10 cm/s, and 20 cm/s) for 150 d, after which the differences in growth and the levels of liver oxidative stress kinase were analyzed. Additionally, potential underlying regulatory pathways were explored using comparative transcriptomic approaches. The results showed that in the feeding environment involving a flow rate of 10 cm/s, the weight increase of P. leopardus and its liver contents of glutathione peroxidase (GPX), alanine aminotransferase (ALT), and superoxide dismutase (T-SOD) were significantly higher than for the other two groups. After matching the comparative transcriptomic results between group pairs (5 cm/s and 10 cm/s, 5 cm/s and 20 cm/s, and 10 cm/s and 20 cm/s), a total of 225 common differential gene expressions were screened. The KEGG pathway enrichment analysis showed that these genes were mainly involved in protein processing in the endoplasmic reticulum, the TGF-β signaling pathway, fatty acid metabolism, fatty acid synthesis, and other pathways. These results not only provide a theoretical basis for the selection of flow velocity in the culture environment of P. leopardus, but also reveal its potential means of adaption to different flow velocities.