Brassinosteroid (BR) signaling is regulated by BRI1-EMS SUPPRESSOR 1 (BES1) transcription factors, which are crucial for plant growth, development, and stress responses. Despite their importance, BES1 gene studies in Medicago sativa L. are limited, hindering our understanding of the BR signaling in this species. This study identified four BES1 genes in M. sativa; characterized their properties, conserved motifs, cis-regulatory elements, and chromosomal location; and explored their functions in development and stress responses. A phylogenetic analysis grouped these genes into two subfamilies. Transcript profiling showed widespread and tissue-specific expression patterns. A qRT-PCR analysis unveiled that most MsBESI genes were upregulated under salt and drought treatments, except MsG0280009980, which was suppressed. This research lays the groundwork for enhancing M. sativa stress resistance and understanding the BES1 gene family’s function.

Stipa bungeana Trin. is a dominant grass species in the warm temperate steppes of northern China; however, its root rot diseases have not been systematically investigated. In this study, 100 root samples of S. bungeana showing typical root rot symptoms were collected from the Sha’erqin Research Base in Tumd Left Banner, Hohhot City, Inner Mongolia, China. A total of 76 fungal isolates, were recovered and identified based on morphological characteristics and multi-locus sequence analysis of the internal transcribed spacer (ITS) region, translation elongation factor 1-alpha (TEF1-α), and the second largest subunit of RNA polymerase II (RPB2) gene. Eight species were identified, of which Curvularia spicifera (25 isolates, 32.89%) and Microdochium bolleyi (24 isolates, 31.58%) were the predominant species. Pathogenicity tests conducted on healthy S. bungeana seedlings under greenhouse conditions demonstrated that all 8 species induced root rot symptoms, thereby, fulfilling Koch’s postulates. Notably, C. spicifera and M. bolleyi exhibited significantly greater virulence than the Fusarium species and the other recovered fungi, resulting in higher disease incidence and plant mortality. This study represents the first comprehensive report of the fungal pathogens associated with root rot of S. bungeana in China and provides the first evidence that C. spicifera and M. bolleyi are the predominant and most virulent pathogens associated with root rot of Stipa species. These findings fill an important critical knowledge gap in grassland plant pathology and provide a scientific foundation for disease management in natural steppe ecosystems.

Alfalfa Verticillium wilt, caused by Verticillium alfalfae, is a globally significant disease with increasing incidence and expanding epidemic areas. This study surveyed six major alfalfa-producing regions in Inner Mongolia, China—Chifeng, Tongliao, Ulanqab, Ordos, Bayannur, and Hohhot—and successfully isolated V. alfalfae exclusively from samples collected in Hohhot and Bayannur. Based on morphological characterization, multi-locus phylogenetic analysis (act, tef1-α, gapdh, and ts genes), and pathogenicity tests fulfilling Koch’s postulates, all 33 isolates were consistently identified as V. alfalfae, with disease severity levels ranging from 3.04 to 4.79 on the susceptible cultivar Zhongmu No. 1. As a preliminary assessment, the in vitro sensitivity of a representative strain, Va8, to eight commercial fungicides was evaluated using the mycelial growth inhibition method. Among the tested fungicides, 30% difenoconazole–propiconazole exhibited the strongest inhibitory effect (EC₅₀ = 0.14 μg/mL), followed by 10% trifloxystrobin & 20% tebuconazole (EC₅₀ = 0.20 μg/mL). However, given the substantial virulence variation observed among isolates, these sensitivity data should be interpreted with caution, as population-level differences may exist. These findings represent the first confirmed report of V. alfalfae in Inner Mongolia and provide a preliminary yet critical reference for prioritizing candidate fungicides for future multi-isolate and field evaluations.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.