Disuse atrophy of skeletal muscle is associated with a severe imbalance in cellular Ca²⁺ homeostasis and marked increase in nuclear apoptosis. Nuclear Ca²⁺ is involved in the regulation of cellular Ca²⁺ homeostasis. However, it remains unclear whether nuclear Ca²⁺ levels change under skeletal muscle disuse conditions, and whether changes in nuclear Ca²⁺ levels are associated with nuclear apoptosis. In this study, changes in Ca²⁺ levels, Ca²⁺ transporters, and regulatory factors in the nucleus of hindlimb unloaded rat soleus muscle were examined to investigate the effects of disuse on nuclear Ca²⁺ homeostasis and apoptosis. Results showed that, after hindlimb unloading, the nuclear envelope Ca²⁺ levels ([Ca²⁺]_NE) and nucleocytoplasmic Ca²⁺ levels ([Ca²⁺]_NC) increased by 78% (p < 0.01) and 106% (p < 0.01), respectively. The levels of Ca²⁺-ATPase type 2 (Ca²⁺-ATPase2), Ryanodine receptor 1 (RyR1), Inositol 1,4,5-tetrakisphosphate receptor 1 (IP₃R1), Cyclic ADP ribose hydrolase (CD38) and Inositol 1,4,5-tetrakisphosphate (IP₃) increased by 470% (p < 0.001), 94% (p < 0.05), 170% (p < 0.001), 640% (p < 0.001) and 12% (p < 0.05), respectively, and the levels of Na⁺/Ca²⁺ exchanger 3 (NCX3), Ca²⁺/calmodulin dependent protein kinase II (CaMK II) and Protein kinase A (PKA) decreased by 54% (p < 0.001), 33% (p < 0.05) and 5% (p > 0.05), respectively. In addition, DNase X is mainly localized in the myonucleus and its activity is elevated after hindlimb unloading. Overall, our results suggest that enhanced Ca²⁺ uptake from cytoplasm is involved in the increase in [Ca²⁺]_NE after hindlimb unloading. Moreover, the increase in [Ca²⁺]_NC is attributed to increased Ca²⁺ release into nucleocytoplasm and weakened Ca²⁺ uptake from nucleocytoplasm. DNase X is activated due to elevated [Ca²⁺]_NC, leading to DNA fragmentation in myonucleus, ultimately initiating myonuclear apoptosis. Nucleocytoplasmic Ca²⁺ overload may contribute to the increased incidence of myonuclear apoptosis in disused skeletal muscle.

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle–bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (p < 0.05, p < 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (p < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (p < 0.05) and bone volume fraction by 15.01% (n = 5, 0.05 < p < 0.1, Cohen’s d = 0.71, 95% CI [−0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis.