The GH growth axis plays an important role in the growth and development of animals and runs through the whole life of animals. Many studies have shown that molecular mutations in key genes of the GH axis will affect the growth and development of animals. The purpose of this study was to explore the distribution characteristics of InDels of GHR, GHRH, and GHRHR in seven Chinese sheep populations, and to further explore the relationship between InDels and sheep growth traits. GHR showed high variation in Chinese sheep, and GHR-53 showed the highest minimum allele frequency (MAF). There was only one InDel mutation site in both GHRH and GHRHR. The genotype frequencies of Hu sheep (HS), Tong sheep (TS), and Lanzhou fat-tail sheep (LFTS) were quite different from other breeds. The association between GHR, GHRH, and GHRHR InDels and body size traits in seven varieties were analyzed. The results showed that there was no significant relationship between GHRH and body size traits in the seven sheep populations. There was a positive association between GHR-21 and hip height of LFSH (p < 0.05). GHR-43 reduced body height and chest depth of Small tail han sheep (STHS) and hip width of TS. GHR-44 significantly affected the body weight of HS, the body height of STHS and the head depth of TS. GHR-53 significantly reduced cannon girth of HS, chest of STHS and forehead width of TS. GHRHR-2 significantly reduced the body weight of LFHS. To sum up, this study revealed the effects of GHR, GHRH, and GHRHR InDels on sheep phenotypic traits, which indicated their potential application prospects in the genetic improvement of mutton sheep.

PSAP (prosaposin) is widely expressed in different organs, and plays an important role in fat deposit. Insertion/Deletion (InDel) is a relatively simple and effective DNA marker. However, the association of molecular marker at different stages of animal development has not received enough attention, especially fat deposition related traits. Therefore, eight cattle breeds were used to explore novel InDels variants within bovine PSAP gene, and to evaluate their effects on growth traits in different development stages. Herein, two novel InDels (P5:NC037355.1g.27974439-27974440 ins AGTGTGGTTAATGTCAAC and P8:NC037355.1g.27980734-27980752 del GTCAAAAAATCAGGGGAAAC) within the bovine PSAP gene were found, and their association with growth traits in different development stages were analyzed. Interestingly, the dominant genotype was different in different development stages both in NY cattle and JX cattle for daily gain and body weight. PSAP Gene expression patterns were analyzed in this study, high expression in the middle stage of adipocytes differentiation suggests that it plays a certain role in fat development. It reveals that InDels could affect phenotype in different development stages, which depend on the expression pattern of the host gene and their function in different tissues. These findings could provide a new way for molecular marker studies in bovine breeding and genetics.

TGF-β signaling pathway plays an important role in regulating cell proliferation and differentiation, embryonic development, bone formation, etc. LTBP1, THBS1, SMAD4 and other genes are important members of TGF-β signaling pathway. LTBP1 binds to TGF-β, while THBS1 binds to LTBP1, which is an important signal transduction molecule in the TGF-β pathway. In order to explore the effects of the insertion/deletion variation of three genes (LTBP1, THBS1, SMAD4) in the TGF-β signaling pathway on the growth traits such as body length and body weight of sheep, a total of 625 healthy individuals from 4 breeds of the Tong sheep, Hu sheep, small-tail Han sheep and Lanzhou fat-tail sheep were identified and analyzed. In this study, we identified 4 InDel loci: one loci of LTBP1, two loci of THBS1, and one loci of SMAD4, respectively named as: InDel-1 (deletion 13 bp), InDel-2 (deletion 16 bp), InDel-3 (deletion 22 bp), InDel-4 (deletion 7 bp). Among the 4 analyzed breeds, association analysis showed that all new InDel polymorphisms were significantly associated with 10 different growth traits (p < 0.05), which may provide a theoretical basis for sheep breeding to accelerate the progression of marker-assisted selection in sheep breeding.

Zinc finger BED-type containing 6 (ZBED6), a highly conservative transcription factor of placental mammals, has conservative interaction of insulin-like growth factor 2 (IGF2) based on the 16 bp binding sites of ZBED6 on the IGF2 sequence. IGF2 is related to embryo growth and cell proliferation. At the same time, its functions in muscle and adipose in mammals have been widely mentioned in recent studies. To further investigate the mechanism of ZBED6 on IGF2, we detected the expression of IGF2 and related genes in ZBED6 single allele knockout (ZBED6-SKO) pig tissues and analyzed the transcriptome of ZBED6-SKO pig liver. Through RNA-seq, we captured nine up-regulated genes and eight down-regulated genes which related to lipid metabolism. The results showed that the mRNA of IGF2 had an upward trend after the partial knockout of ZBED6 in liver and had no significant difference in protein expression of IGF2. In summary, ZBED6-SKO could affect the secretion of IGF2 in pig liver and its own lipid metabolism. Our research has provided basic information for revealing the regulatory mechanism of the interaction between ZBED6 and IGF2 in mammals.