The recent evolution of the SARS-like Coronavirus has ravaged the world. The deadly virus has claimed over millions of lives across the world and hence highlights the need to develop effective therapeutic drugs to contain the disease posed by this parasite. In this study, the inhibitory potential of fifty (50) dietary polyphenols against Coronavirus (SARS-CoV-2) main protease (Mpro) was conducted using the Autodock Vina Molecular docking tool. In the virtual screening process, the binding affinity of Remdesivir (-7.7 kcal/mol) currently used to treat COVID-19 patients was set as the cut-off value to screen out less probable inhibitors. Ellagic acid, Kievitone, and Punicalin were the only promising ligands with binding affinities (-8.9 kcal/mol, -8.0 kcal/mol and -7.9 kcal/mol respectively) lower than the set cut-off value. Furthermore, we validated Ellagic acid and Kievitone efficacy by subjecting them to molecular dynamics simulation and further stability was assessed at the molecular mechanics and quantum levels. The overall analysis indicates both compounds demonstrate higher stability and inhibitory potential to bind to the crucial His41 and Cys145 catalytic dyad of Mpro than the standard drug. However, further analysis of punicalin after evaluating its docking score was not conducted as the ligand pharmacokinetics properties suggests it could pose serious adverse effect to the health of participants in clinical trials. Hence, we employed a more safe approach by filtering out the compound during this study. Conclusively, while Ellagic acid and kievitone polyphenolic compounds have been demonstrated to be promising under this in silico research, further studies are needed to substantiate their clinical relevance.

The emergence of the novel coronavirus (SARS‐CoV‐2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS‐CoV‐2, a class I fusion protein that aids ACE2 (angiotensin‐converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication‐defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole‐inactivated SARS‐CoV‐2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA‐based) vaccine candidate. The “YLQPRTFLL” peptide sequence (position 269–277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A‐0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll‐like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence “UACCUGCAGCCGCGUACCUUCCUGCUG” exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS‐CoV‐2 infection.

Cyclophilins are a subgroup of highly conserved protein family immunophilins which are peptidyl-prolyl isomerases that interconvert between the cis and trans positions. They can act as chaperones in maintaining conformational quality control of proteomes. They are structurally conserved throughout evolution and have been found in mammals, plants, insects, fungi, and bacteria. They share a common fold architecture consisting of 8 antiparallel beta sheets and two alpha helices that pack against the sheets. They exist in the cellular compartment of most tissues and encode special functions. Intracellular Cyclophilins are secreted from cells in response to inflammatory stimuli and can mediate intercellular communication. Pro-inflammatory signals may be stimulated by extracellular Cyclophilin. Overexpression of Cyclophilins can contribute to pathological conditions. Cyclophilins are involved in the pathogenesis of viral infection, neurodegenerative diseases, ageing and cancer. Exhibiting several molecular functions, Cyclophilins can bind to cyclosporine and calcium-dependent ser/thr Calcineurin and has been used to describe the immunosuppressive action of cyclosporine. Cyclophilin can stabilize the cis-trans conformation transition state and speed up isomerization steps in protein folding. This process is important in the assembly of multiple domain proteins. Their existence as foldases and molecular chaperones enable them to be able to assist in the covalent folding or unfolding and the assembly or disassembly of other macromolecular structures.

BCL2 associated anthanogene (BAG)s are class of proteins linked to tumorigenesis and apoptosis. Therefore, it is of interest to design and develop potent inhibitors for BAG. Hence, we report the optimal structure-based docked features of sesamolin with BAG3 with the acceptable ADMET properties for consideration in the context of Glioblastoma Multiforme treatment and therapy.