There has been a recent shift in the prevalence of Potato virus Y (PVY) strains affecting potato with the ordinary strain PVY^O declining and the recombinant strains PVY^NTN and PVY^N:O emerging in the United States. Multiple PVY strains are commonly found in potato fields and even in individual plants. Factors contributing to the emergence of the recombinant strains are not well defined but differential aphid transmission of strains from single and mixed infections may play a role. We found that the transmission efficiencies by Myzus persicae, the green peach aphid, of PVY^NTN, PVY^N:O, and PVY^O varied depending on the potato cultivar serving as the virus source. Overall transmission efficiency was highest from sources infected with three virus strains, whereas transmission from sources infected with one or two virus strains was not significantly different. Two strains were concomitantly transmitted by individual aphids from many of the mixed-source combinations, especially if PVY^O was present. Triple-strain infections were not transmitted by any single aphid. PVY^O was transmitted most efficiently from mixed-strain infection sources. The data do not support the hypothesis that differential transmission of PVY strains by M. persicae is a major contributing factor in the emergence of recombinant PVY strains in the U.S. potato crop.

Single aphids can simultaneously or sequentially acquire and transmit multiple potato virus Y (PVY) strains. Multiple PVY strains are often found in the same field and occasionally within the same plant, but little is known about how PVY strains interact in plants or in aphid stylets. Immuno-staining and confocal microscopy were used to examine the spatial and temporal dynamics of PVY strain mixtures (PVYO and PVYNTN or PVYO and PVYN) in epidermal leaf cells of ‘Samsun NN’ tobacco and ‘Goldrush’ potato. Virus binding and localization was also examined in aphid stylets following acquisition. Both strains systemically infected tobacco and co-localized in cells of all leaves examined; however, the relative amounts of each virus changed over time. Early in the tobacco infection, when mosaic symptoms were observed, PVYO dominated the infection although PVYNTN was detected in some cells. As the infection progressed and vein necrosis developed, PVYNTN was prevalent. Co-localization of PVYO and PVYN was also observed in epidermal cells of potato leaves with most cells infected with both viruses. Furthermore, two strains could be detected binding to the distal end of aphid stylets following virus acquisition from a plant infected with a strain mixture. These data are in contrast with the traditional belief of spatial separation of two closely related potyviruses and suggest apparent non-antagonistic interaction between PVY strains that could help explain the multitude of emerging recombinant PVY strains discovered in potato in recent years.

Viruses transmitted by the whitefly (Bemisia tabaci) are an increasing threat to cucurbit production in the southwestern United States and many other cucurbit production regions of the world. The crinivirus cucurbit yellow stunting disorder virus (CYSDV) has severely impacted melon production in California and Arizona since its 2006 introduction to the region. Within the past few years, another crinivirus, cucurbit chlorotic yellows virus (CCYV), and the whitefly-transmitted ipomovirus squash vein yellowing virus (SqVYV) were found infecting melon plants in California’s Imperial Valley. CYSDV, CCYV, and an aphid-transmitted polerovirus, cucurbit aphid-borne yellows virus (CABYV), occur together in the region and produce identical yellowing symptoms on cucurbit plants. Mixed infections of these four viruses in the Sonoran Desert and other regions pose challenges for disease management and efforts to develop resistant varieties. A multiplex single-step RT-PCR method was developed that differentiates among these viruses, and this was used to determine the prevalence and distribution of the viruses in melon samples from fields in the Sonoran Desert melon production region of California and Arizona during the spring and fall melon seasons from 2019 through 2021. TaqMan probes were developed, optimized, and applied in a single-step multiplex RT-qPCR to quantify titers of these four viruses in plant samples, which frequently carry mixed infections. Results of the multiplex RT-PCR analysis demonstrated that CYSDV is the predominant virus during the fall, whereas CCYV was by far the most prevalent virus during the spring each year. Multiplex RT-qPCR was used to evaluate differential accumulation and spatiotemporal distribution of viruses within plants and suggested differences in competitive accumulation of CCYV and CYSDV within melon. This study provides the first official report of SqVYV in Arizona and offers an efficient method for virus detection and quantification for breeding and disease management in areas impacted by cucurbit yellowing viruses.

In California, the whitefly-transmitted yellowing viruses, cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV), both genus Crinivirus, fam. Closteroviridae, have been limited to the Sonoran Desert production regions of Imperial and Riverside counties since their emergence in 2006 and 2014, respectively (Kuo et al., 2007; Wintermantel et al., 2009, 2019) where losses to these viruses have nearly eliminated fall melon production. CYSDV and CCYV have never been identified in the Central Valley, but the aphid-transmitted cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, fam. Luteoviridae) which produces symptoms nearly identical to those induced by CYSDV and CCYV (Lemaire et al. 1993) is common. As part of a larger study to monitor for whitefly-transmitted yellowing viruses in the southwestern United States, melon leaves exhibiting foliar mottling and interveinal chlorosis beginning near the crown and spreading outward along vines (e-Xtra 1), typical of symptoms caused by yellowing viruses, were collected from 106 melon plants in four commercial fields and a research plot in Fresno County, California, during October 2020. Whiteflies (B. tabaci) were present in all fields and confirmed as MEAM1 (biotype B) by PCR. Total RNA and DNA were extracted separately from the same leaf from each plant to determine the presence of RNA and DNA viruses. Total RNA was extracted as described in Tamang et al. (2021), and was used in RT-PCR with primer sets designed to amplify a 277 nt portion of the CABYV RNA dependent RNA polymerase (RdRp) gene (CABYV RdRp-F - 5' AAGAGCGGCAGCTACAATAC 3', CABYV RdRp-R - 5' TGCCACATTCCGGTTCATAG 3'), and portions of the CCYV and CYSDV RdRp genes encoded on RNA1 of the latter two viruses (Kavalappara et al., 2021). In addition, each CYSDV and CCYV infection was confirmed using a second set of primers that amplified 394 and 372 nt portions of the coat protein gene of each virus, respectively, encoded on RNA2 (Wintermantel et al., 2009; 2019). The 953 nt CCYV RdRp and 394 nt CYSDV CP amplicons were sequenced and found to share greater than 98% sequence identity to CCYV RNA1 (Accession No. MH477611.1) and CYSDV RNA2 (Accession No. LT992901.1), respectively. The CABYV infections were secondarily confirmed using a second set of primers designed to the CP gene (Kassem et al. 2007). Furthermore, four RNA samples from two separate fields that previously tested positive for CYSDV and CABYV and the only CCYV infection were confirmed using a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted). Total DNA was extracted using methods described in Mondal et al. (2016) and was used in PCR to test for the presence of the whitefly-transmitted begomovirus, cucurbit leaf crumple virus (CuLCrV) which also occurs in the Sonoran Desert melon production region (Hagen et al, 2008), and is capable of inducing yellowing and leaf curl symptoms in melon. CABYV was by far the most prevalent virus, infecting 34/106 plants tested (32%) among the five fields. Four plants from three fields were infected singly with CYSDV (4%), and three more CYSDV infected plants from two fields were co-infected with CABYV (3%). Only one plant was found to be infected with CCYV as a single virus infection (1%). No triple infections nor any CuLCrV were detected in any of the plants sampled. This is the first report of CYSDV and CCYV in the Central Valley of California. In this survey, although CABYV was the predominant yellowing virus infecting melons in the Central Valley (32%), detection of CYSDV in fields distant from one another and the presence of CCYV even in a single field warrant more extensive monitoring of cucurbit crops and known alternate hosts of these viruses in the Central Valley.

The United States potato industry has recently experienced a strain shift; recombinant potato virus Y (PVY) strains (e.g., PVY^NTN) have emerged as the predominant strains over the long dominant ordinary strain (PVY^O), yet both are often found as single infections within the same field and as mixed infections within individual plants. To understand mixed infection dynamics in potato plants and in daughter tubers, three potato varieties varying for PVY resistance, ‘Red Maria’, ‘CalWhite’, and ‘Pike’, were mechanically inoculated either at the pre- or postflowering stage with all possible heterologous isolate combinations of two PVY^O and two PVY^NTN isolates. Virus titer was determined from leaves collected at different positions on the plant at different times, and tuber-borne infection was determined for two successive generations. PVY^NTN accumulated to higher levels than PVY^O at nearly all sampling time points in ‘Pike’ potato. However, both virus strains accumulated to similar amounts in ‘Red Maria’ and ‘CalWhite’ potato early in the infection when inoculated preflowering; however, PVY^NTN dominated at later stages and in plants inoculated postflowering. Regardless of inoculation time, both virus strains were transmitted to daughter plants raised from the tubers for most isolate combinations. The relative titer of PVY^NTN and PVY^O isolates at the later stages of mother plant development was indicative of what was found in the daughter plants. Although virus titer differed among cultivars depending on their genetics and virus isolates, it did not change the strain outcome in tuber-borne infection in subsequent generations. Differential virus accumulation in these cultivars suggests isolate-specific resistance to PVY accumulation.

During the summer and fall of 2020, foliar yellowing symptoms, including leaf mottle and interveinal yellowing with green veins were observed on several melon, squash, and cucumber plants in commercial fields in Alabama, USA. These foliar symptoms were similar to those caused by the whitefly-transmitted yellowing viruses, cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) (both genus Crinivirus, Closteroviridae). A total of 231 leaf samples showing yellowing, interveinal chlorosis, and mottling (e-Xtra 1, 2) were collected from individual plants from 25 commercial fields in Alabama (70 watermelon, 52 melon, 34 pumpkin, 50 squash, and 25 cucumber) during two sampling periods, June (spring/summer season) and October (fall season) 2020. Total RNA, extracted as described in Tamang et al. (2021), was used in reverse transcription polymerase chain reaction (RT-PCR) with primer sets designed to amplify portions of the CCYV and CYSDV RNA-dependent RNA polymerase (RdRp) genes encoded on RNA1 of these viruses (Mondal et al. 2021, submitted; Kavalappara et al., 2021). Single infections of either CYSDV or CCYV were found in 53 of 57 infected cucurbit samples (of 231 total plants), whereas both viruses were detected in four samples, all squash. In June 2020 near the end of the spring season, CYSDV was identified from 20 of 114 total cucurbit plants tested (17.5%), but CCYV was not identified from any plants. During the fall season, 37 of 117 plants (32%) tested positive for the presence of one or both criniviruses. Of the 37 virus-positive samples from the fall season, 26 were singly infected with CCYV (70%), seven were singly infected with CYSDV (19%), and four were infected with both CYSDV and CCYV (11%). The RdRp amplicon was sequenced from three CCYV-infected plants (2 squash; GenBank Accession No. MZ073347, MZ073348; 1 cucumber, MZ073349) and one CYSDV-infected plant (melon, MZ073350); the 857 nt sequenced portion of the CCYV RdRp gene was found to share 99% identity with the same sequence of CCYV RNA1 isolates from Israel (MH477611.1) and California (MW680157), whereas the 494 nt CYSDV amplicon shared 100% sequence identity with the comparable sequence from RNA1 of a CYSDV isolate from Arizona (EF547827.1). In addition, all of the CYSDV and CCYV infections were confirmed using a second set of primers that amplified 394 and 372 nt sections of the coat protein gene of each virus, respectively (Wintermantel et al., 2009; 2019), encoded on RNA2 of each viral genome. Furthermore, a recently developed multiplex RT-qPCR method (Mondal et al. 2021, submitted) was used to confirm four representative CYSDV and CCYV infections each. This is the first report of CYSDV and CCYV in cucurbit crops from Alabama. Surprisingly, CYSDV was only found in melon plants (20 of 52, 38%), whereas CCYV was only found in squash, pumpkin, and cucumber (26 of 109, 24%); no watermelon plants were infected with either virus, even though watermelon is a known host of both viruses. The identification of CCYV and CYSDV in Alabama, along with a recent report of both criniviruses from nearby Georgia (Kavalappara et al., 2021) illustrates the need for a more thorough sampling of cucurbit crops, further monitoring of the whitefly vector, Bemisia tabaci, and the identification of alternate hosts of these viruses to better understand the epidemiology of these viruses in Alabama and throughout the Gulf Coast region.