Viruses are dependent on host factors at all parts of the infection cycle, such as translation, genome replication, encapsidation, and cell-to-cell and systemic movement. RNA viruses replicate their genome in compartments associated with the endoplasmic reticulum, chloroplasts, and mitochondria or peroxisome membranes. In contrast, DNA viruses replicate in the nucleus. Viral infection causes changes in plant gene expression and in the subcellular localization of some host proteins. These changes may support or inhibit virus accumulation and spread. Here, we review host proteins that change their subcellular localization in the presence of a plant virus. The most frequent change is the movement of host cytoplasmic proteins into the sites of virus replication through interactions with viral proteins, and the protein contributes to essential viral processes. In contrast, only a small number of studies document changes in the subcellular localization of proteins with antiviral activity. Understanding the changes in the subcellular localization of host proteins during plant virus infection provides novel insights into the mechanisms of plant–virus interactions and may help the identification of targets for designing genetic resistance to plant viruses.

The Dominican Republic has a significant area of the country cultivated with vegetables. In July 2013, in the provinces of Moca and La Vega, horticultural crops showed typical tospovirus symptoms (>30% incidence), including bronzing, chlorosis, necrosis, and ring spots on leaves and fruits. Samples were collected from potatoes (Solanum tuberosum), long beans (Vignaun guiculata), chili peppers (Capsicum frutescens), sweet peppers (C. annuum), and tomatoes (S. lycopersicum). Serological tests were clearly positive for infection by Tomato spotted wilt virus (TSWV) and/or related tospoviruses when tested with AgDia immunostrips. The viral RNA extracted from five plants per host was pooled to construct a cDNA library that was sequenced using an Illumina HiSeq 2000 platform. The paired-end reads were assembled using CLC Genomic Workbench version 6.0.3. The assembled contigs were submitted to BLASTx against a viral genome database. The results confirmed the presence of Tomato chlorotic spot virus (TCSV) and TSWV. Then, PCR tests were performed with primers pairs TSWV-LF 5' CTGTTGTCTATTGAGGATTGTG 3' AND TSWV-LR 5' CAGAGAGCTTGTTAATGCAGGAC 3' to amplify part of the TSWV L RNA, the pairs TCSV-SF 5' AACTGGGAAAGCAGAAAACC 3' and TCSV-SR 5' CCTTACTCCGAACATTGCA 3', and GRSV-SF 5' CTGTCAGGAAAATCTTGACCTG 3' and GRSV-SR 5' CTTGACTCCAAACATCTCGT 3' to detect part of the TCSV and Groundnut ringspot virus (GRSV) S segments. In the long bean and chili pepper samples from La Vega, only TCSV was detected (40% of the all samples) based on amplification of the expected size fragment with the S RNA specific primer pair. All the other samples were positive for TSWV and no GRSV was detected. The complete N gene of TCSV and TSWV were amplified using the primer pairs TCSV-NR2 5' CACACTGAACTGAACTATAACACAC 3' and TCSV-NF 5' ACCTTGAATCATATCTCTCG 3' and primers N-TSWV_FW 5' TACGGATCCGATGTCTAAGGTTAAGCTCAC 3' and N-TSWV_RV 5' TTATCTCGAGTCAAGCAAGTTCTGCGAG 3'. The TCSV N protein sequences (KJ399303 and KJ399304) were 99% identical with the TCSV found in processing tomatoes in the Dominican Republic (1) and the United States (2). The TSWV N protein sequences (KJ399313, KJ399314 and KJ399315) shared 96 to 98% identity with the TSWV N sequences available. Dot blot hybridization tests (1) using DIG-labeled specific TCSV N gene probe confirmed TCSV infection in PCR-positive long bean and chili pepper samples, whereas no hybridization signal was detected for TSWV-infected tomatoes, potatoes, sweet peppers, or healthy samples. In addition, no reassortants were detected based on amplification of the expected size RNA fragments (3). These other amplicons (KJ399301, KJ399299, KJ399302, and KJ399300) showed 98% identity with the L and M segments of TCSV. Thrips collected from symptomatic plants were identified mainly as Frankliniella schultzei, consistent with the main thrips species transmitting TCSV. In the last two years, TCSV was reported in North and Central America and in the Caribbean Basin (1,2,4). These findings have an important epidemiological impact since TCSV represents a new threat to other horticultural crops affected by this tospovirus. References: (1) O. Batuman et al. Plant Dis. 98:286, 2014. (2) A. Londono et al. Trop. Plant Pathol. 37:333, 2012. (3) C. G. Webster et al. Virology 413:216, 2011. (4) C. G. Webster et al. Plant Health Progress. Online publication. doi:10.1094/PHP-2013-0812-01-BR, 2013.

Natural infection with SARS-CoV-2 and vaccines triggers the formation of antibodies against the S glycoprotein, which are detected by antibody-based diagnostic tests. Our analysis showed that variation in the S glycoprotein is a general feature of all species in the genus Betacoronavirus , including three species that infect humans: SARS-CoV, SARS-CoV-2, and MERS-CoV.

The Tomato chlorotic spot virus (TCSV) was first reported in the 1980s, having its occurrence limited to Brazil and Argentina. Due to an apparent mild severity in the past, molecular studies concerning TCSV were neglected. However, TCSV has disseminated over the USA and Caribbean countries. In Dominican Republic TCSV has been recently reported on important cultivated crops such as pepper and beans. In this work, we provide the first complete genome of a TCSV isolate from symptomatic plants in Dominican Republic, which was obtained by high-throughput sequencing. In addition, three dsRNA viruses from different virus families were identified coinfecting these plants Bell pepper endornavirus (BPEV), Southern tomato virus (STV) and Pepper cryptic virus 2 (PCV-2). Phylogenetic analysis showed that the Dominican Republic TCSV isolate has a close relationship with other TCSV isolates and a reassortant isolate between TCSV and Groundnut ringspot virus (GRSV), all found in USA. BPEV, STV and PCV-2 isolates from Dominican Republic were close related to corresponding American isolates. The possible biological implications of these virus-mixed infections are discussed.

Monitoring avocado (Persea americana Mill., cv. Semil-34) in tropical mountain landscapes of Cambita, San Cristóbal, Dominican Republic is inherently complex due to the pronounced topographical and climatic heterogeneity that modulates the crop’s ecophysiological responses, specifically vegetative vigor, carbon allocation, and the synchronization of reproductive flushes. This study integrates 5-year (2020–2025) Sentinel-2 time series, ERA5-Land climatic variables (air temperature, total precipitation, and radiation), and geomorphometric covariates to explain variability in yield and fruit quality. Multispectral indices, including the Normalized Difference Vegetation Index (NDVI), Enhanced Vegetation Index (EVI), Normalized Difference Red Edge (NDRE), and Normalized Difference Moisture Index (NDMI), were analyzed using Partial Least Squares Regression (PLSR) to characterize phenological dynamics and rank dominant predictors. The results revealed coherent spectral phenological trajectories; however, a significant inverse relationship was detected between canopy vigor and yield during reproductive phases. High vegetation index values were significantly and negatively associated with lower production (r = −0.58, p < 0.0021), reflecting a potential source–sink imbalance. Topography functioned as a structural filter, regulating root drainage and productive stability across the landscape. While yield variability was partially explainable (R² = 0.38), internal fruit quality, measured as dry matter content, exhibited comparatively high environmental stability. A central contribution of this research lies in identifying the “vigor paradox” in cv. Semil-34 and the suggestion that topography may exert a stronger influence than direct spectral signals under tropical hillside conditions. These findings provide an exploratory framework for anticipating yield and fruit quality through satellite remote sensing or UAVs, supporting site-specific management decisions in mountain agricultural systems.