As non-renewable resource, the recovery and utilization of phosphorus from wastewater is an enduring topic. Stimulated by the advances in research on polyphosphates (polyP) as well as the development of Enhanced Biological Phosphorus Removal (EBPR) technology to achieve the efficient accumulation of polyP via polyphosphate accumulating organisms (PAOs), a novel phosphorus removal strategy is considered with promising potential for application in real wastewater treatment processes. This review mainly focuses on the mechanism of phosphorus aggregation in the form of polyP during the phosphate removal process. Further discussion about the reuse of polyP with different chain lengths is provided herein so as to suggest possible application pathways for this biosynthetic product.

With numerous industrial applications, Paenibacillus polymyxa has been accepted as the candidate of the cell factory for many secondary metabolites. However, as the regulatory expression elements in P. polymyxa have not been systematically investigated, genetic modification on account of a specific metabolism pathway for the strain is limited. In this study, a xylose-inducible operon in the xylan-utilizing bacterium ATCC842 was identified, and the relative operon transcription was increased to 186-fold in the presence of xylose, while the relative enhanced green fluorescent protein (eGFP) fluorescence intensity was promoted by over four-fold. By contrast, glucose downregulated the operon to 0.5-fold that of the control. The binding site of the operon was “ACTTAGTTTAAGCAATAGACAAAGT”, and this can be degenerated to “ACTTWGTTTAWSSNATAVACAAAGT” in Paenibacillus spp., which differs from that in the Bacillus spp. xylose operon. The xylose operon binding site was transplanted to the constitutive promoter Pshuttle-09. The eGFP fluorescence intensity assay indicated that both the modified and original Pshuttle-09 had similar expression levels after induction, and the expression level of the modified promoter was decreased to 19.8% without induction. This research indicates that the operon has great potential as an ideal synthetic biology tool in Paenibacillus spp. that can dynamically regulate its gene circuit strength through xylose.

Aerobic denitrification is considered as a promising biological method to eliminate the nitrate contaminants in waterbodies. However, the molecular mechanism of this process varies in different functional bacteria. In this study, the nitrogen removal characteristics for a newly isolated aerobic denitrifier Bacillus subtilis JD-014 were investigated, and the potential functional genes involved in the aerobic denitrification process were further screened through transcriptome analysis. JD-014 exhibited efficient denitrification performance when having sodium succinate as the carbon source with the range of nitrate concentration between 50 and 300 mg/L. Following the transcriptome data, most of the up-regulated differentially expressed genes (DEGs) were associated with cell motility, carbohydrate metabolism, and energy metabolism. Moreover, gene nirsir annotated as sulfite reductase was screened out and further identified as a regulator participating in the nitrogen removal process within JD-014. The findings in present study provide meaningful information in terms of a comprehensive understanding of genetic regulation of nitrogen metabolism, especially for Bacillus strains.

In this study, four kinds of phospholipase A1-metal (Al/Co/Cu/Mn) hybrid nanostructures were prepared for enhancing the stability of the free PLA1. The formed hybrid complexes were characterized by scanning electron microscope (SEM), Fourier infrared spectroscopy (FTIR), and X-ray diffraction (XRD). The stability and substrate specificity of immobilized enzymes were subsequently determined. After immobilization, the temperature tolerance of PLA1–metal hybrid nanostructures was enhanced. The relative activity of PLA1–Al/Co/Cu hybrid nanostructures remained above 60% at 50 °C, while that of free enzyme was below 5%. The thermal transition temperature measured by differential scanning calorimetry (DSC) was found to increase from 65.59 °C (free enzyme) to 173.14 °C, 123.67 °C, 96.31 °C, and 114.79 °C, referring to PLA1–Cu/Co/Al/Mn hybrid nanostructures, respectively. Additionally, after a storage for fourteen days at 4 °C, the immobilized enzymes could exhibit approximately 60% of the initial activity, while the free PLA1 was inactivated after four days of storage. In brief, using Co²⁺, Cu²⁺, Al³⁺, and Mn²⁺ as the hybridization materials for immobilization could improve the catalytic properties and stability of the free PLA1, suggesting a promising method for a wider application of PLA1 in many fields such as food, cosmetics, and the pharmaceutical industry.