In Myanmar, yellow mosaic and leaf curl diseases caused by whitefly-transmitted begomoviruses are serious problems for vegetables such as tomatoes and peppers. To investigate the incidence of begomoviruses in Myanmar between 2017 and 2019, a field survey of tomato and pepper plants with virus-like symptoms was conducted in the Naypyitaw, Tatkon, and Mohnyin areas of Myanmar. Among the 59 samples subjected to begomovirus detection using polymerase chain reaction, 59.3% were infected with begomoviruses. Complete genome sequences using rolling circle amplification identified five begomovirus species: tomato yellow leaf curl Thailand virus (TYLCTHV), tomato yellow leaf curl Kanchanaburi virus (TYLCKaV), tobacco leaf curl Yunnan virus (TbLCYnV), chili leaf curl Pakistan virus (ChiLCV/PK), and tobacco curly shoot Myanmar virus (TbCSV-[Myanmar]). Excluding the previously reported TYLCTHV, three begomoviruses (ChiLCV/PK, TYLCKaV, and TbLCYnV) were identified in Myanmar for the first time. Based on the 91% demarcation threshold of begomovirus species, TbCSV-[Myanmar] was identified as a new species in this study. Among these, ChiLCV/PK and TbCSV-[Myanmar] were the most predominant in tomato and pepper fields in Myanmar. Identification of begomovirus species may be helpful for predicting the origin of viruses and preventing their spread.

Fraxinus rhynchophylla, common name ash, belongs to the family Oleaceae and is found in China, Korea, North America, the Indian subcontinent, and eastern Russia. It has been used as a traditional herbal medicine in Korea and various parts of the world due to its chemical constituents. During a field survey in March 2019, mild vein thickening (almost negligible) was observed in a few ash trees. High-throughput sequencing of libraries of total DNA from ash trees, rolling-circle amplification (RCA), and polymerase chain reaction (PCR) allowed the identification of a Fraxinus symptomless virus. This virus has five confirmed open reading frames along with a possible sixth open reading frame that encodes the movement protein and is almost 2.7 kb in size, with a nonanucleotide and stem loop structure identical to begomoviruses. In terms of its size and structure, this virus strongly resembles begomoviruses, but does not show any significant sequence identity with them. To confirm movement of the virus within the trees, different parts of infected trees were examined, and viral movement was successfully observed. No satellite molecules or DNA B were identified. Two-step PCR confirmed the virion and complementary strands during replication in both freshly collected infected samples of ash tree and Nicotiana benthamiana samples agro-inoculated with infectious clones. This taxon is so distantly grouped from other known geminiviruses that it likely represents a new geminivirus genus.

In October 2018, cucumber plants showing yellowing and chlorotic mottle symptoms were observed in a greenhouse in Chungbuk, South Korea. The observed symptoms were similar to those caused by cucurbit aphid-borne yellows virus (CABYV), which has been detected on cucumber plants in the region since it was reported on melon in Korea in 2015 (Lee et al 2015). To identify the potential agents causing these symptoms, 28 samples from symptomatic leaves and fruit of cucumber plants were subjected to total RNA extraction using the Plant RNA Prep Kit (Biocubesystem, Korea). Reverse transcription polymerase chain (RT-PCR) was performed on total RNA using CABYV specific primers and protocols (Kwak et al. 2018). CABYV was detected in 17 of the 28 samples, while 11 symptomatic samples tested negative. In order to identify the cause of the symptoms, RT-PCR was performed using cucurbit chlorotic yellows virus (CCYV) and cucurbit yellow stunting disorder virus (CYSDV) specific primers (Wintermantel et al. 2019). Eight of the 28 samples were positive using the CCYV specific primers while seven samples were infected with only CCYV and one contained a mixed infection of CABYV with CCYV. None of the samples tested positive for CYSDV. The expected 373 nt amplicons of CCYV were bi-directionally sequenced, and BLASTn analysis showed that the nucleotide sequences shared 98 to 100% identity with CCYV isolates from East Asia, including NC0180174 from Japan. Two pairs of primers for amplification of the complete coat protein and RNA-dependent RNA polymerase (RdRp) genes (Wintermantel et al., 2019) were used to amplify the 753bp coat protein and 1517bp RdRp genes, respectively. Amplicons of the expected sizes were obtained from a CCYV single infection and ligated into the pGEM T- Easy vector (Promega, WI, USA). Three clones from each amplicon were sequenced and aligned using Geneious Prime and found to have identical sequences (Genbank accession nos. MW033300, MW033301). The CP and RdRp sequences demonstrated 99% nucleotide and 100% amino acid identity with the respective genes and proteins of the CCYV isolates from Japan. This study documents the first report of CCYV in Korea. Since CCYV was first detected on melon in Japan, it has been reported in many other countries including those in East Asia, the Middle East, Southern Europe, North Africa, and recently in North America. CCYV has the potential to become a serious threat to production of cucurbit crops in Korea, particularly due to the increasing prevalence of the whitefly, Bemisia tabaci, in greenhouse production systems. It will be important to continue monitoring for CCYV and determine potential alternate hosts in the region to manage and prevent further spread of CCYV in Korea.

Watermelon (Citrullus lanatus) is one of the most popular crops in Korea, with over 100 million units produced annually. As watermelon cultivation increases, the damage caused by plant viruses in w...

Viburnum lentago (family Adoxaceae) is a perennial plant species native to northeastern United States and southern Canada. Globally, V. lentago is a popular garden plant due to its abundant flowers...

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.