The root-knot nematodes (Meloidogyne spp) are difficult to manage once established in the field because of their wide host range, and soil-borne nature. Thus, the aim of the present study was to examine the use of resistant root stock of wild brinjal (Solanum sisymbriifolium) to reduce the loss caused by the nematodes on tomato. For the management of root-knot nematodes, grafted plant with resistant root stock of the wild brinjal was tested under farmers’ field conditions at Hemza of Kaski district. Grafted and non-grafted plants were produced in root-knot nematode-free soil. Around three week-old grafted and non-grafted tomato plants were transplanted in four different plastic tunnels where root-knot nematodes had been reported previously. The plants were planted in diagonal position to each other as a pair plot in 80 × 60 cm2 spacing in an average of 20 × 7 m2 plastic tunnels. Galling Index (GI) was recorded three times in five randomly selected plants in each plot at 60 days intervals. The first observation was recorded two months after transplanting. Total fruit yield was recorded from same plants. In the grafted plants, the root system was totally free from gall whereas in an average of 7.5 GI in 0-10 scale was recorded in the non-grafted plants. Fruits were harvested from time to time and cumulated after final harvest to calculate the total fruit yield. It was estimated that on an average tomato fruit yield was significantly (P>0.05) increased by 37 percent in the grafted plants compared with the non-grafted plants. Grafting technology could be used effectively for cultivation of commonly grown varieties, which are susceptible to root-knot nematodes in disease prone areas. This can be used as an alternative technology for reducing the use of hazardous pesticides for enhancing commercial organic tomato production.Journal of Nepal Agricultural Research Council Vol.3 2017: 27-31

Rhizoctonia root rot and web blight caused by Rhizoctonia solani Kühn is one of the destructive diseases of the common bean (Phaseolus vulgaris L.). A two-year study was conducted (2019–2021) to evaluate the common bean landraces and genotype, biocontrol agents, and chemical fungicides against the pathogen. Nine landraces from high-altitude agriculture in the Jumla district in western Nepal (29.27443900, 82.19332200; 2540 m msl) and one genotype of commercial common bean from the sub-tropical Chitwan district in central Nepal (27.65186564, 84.34869288; 256 m masl) were evaluated for resistance against the pathogen under screenhouse and field conditions. All were found highly susceptible to the pathogen and the highest lesion length (3.02 cm) was measured in the Rato Male Simi followed by Rato Sano Chhirke Simi (2.40 cm) in Chitwan conditions. Three chemical fungicides—SAAF™ (carbendazim 12% + mancozeb 63% WP), Vitavax^® (carboxin 37.5% + thiram 37.5% DS), and Nativo^® (tebuconazole 50% + trifloxystrobin 25% w/w (75 WG)—and three biocontrol agents—Trichoderma viride (10⁹ cfu/mL), Pseudomonas fluorescens (10⁹ cfu/mL), and Bacillus subtilis (10⁸ cfu/mL)—were evaluated as seed and soil treatments in fourteen different combinations against R. solani. SAAF™ and Vitavax^® were found highly effective as they completely suppressed the incidence of pre-emergence damping off. SAAF™ was equally effective followed by Vitavax^® and Nativo^® in suppressing post-emergence damping off. On the other hand, the highest disease incidence (26.63%) was recorded in treatment where seed treatment with Pseudomonas fluorescens formulation at the rate of 10 g per kg of FYM slurry along with soil application with Pseudomonas fluorescens formulation at the rate of 10 kg per ha with 50 kg FYM was applied, whereas the lowest disease incidence (4.96%) occurred in SAAF™ for both seed and soil applications. Highest grain yield (4125 kg/ha) was recorded on Nativo^® where seed treatment at the rate of 1.5 g per kg along with soil drenching at the rate of 1.5 g per liter was used. Thus, it can be concluded that the best control for pre-emergence damping off was achieved by SAAF™ where seed treatment at the rate of 2 g per kg along with soil drenching at the rate of 2 g per liter and Vitavax^® as seed treatment at the rate of 2 g per kg along with soil drenching at the rate of 2 g per liter was used, while the best control of post-emergence damping off was achieved with combined seed treatment and soil treatment with SAAF™. There was no incidence of web blight throughout the growing period. Our findings could be useful in devising strategies for the integrated management of R. solani causing root rot disease in common beans.

Strawberry (Fragaria x ananassa Duch.) was introduced to Nepal from Japan in the 1990s, and thus, is a relatively new crop in the country. After the initial introduction of cultivar 'Nyoho' in Kakani, Nuwakot, different agencies and growers have introduced a number of cultivars in large numbers from Japan, Europe, America and India to expand the cultivation of strawberry in Nepal. Such practice has increased the risk of introducing new pathogens in the country. During a field visit at Kakani in October 2018, virus-like symptoms were observed in 5-10% of the plants in a polyhouse (~200 m2). Three strawberry leaf samples showing vein banding, vein clearing or tip necrosis with leaf puckering were collected. Total RNA was extracted from leaves using the RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high-throughput sequencing (HTS). After ribosomal RNA depletion using the Ribo-Zero rRNA kit, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo transcriptome assembly of the 67,748,658 reads with Trinity software (r20140717) yielded 116,854 contigs of 201-17,773 nucleotides (nt). BLASTn and BLASTx analysis of the contigs against the NCBI viral reference database showed that one contig with the nearly full genome sequence (5,968 nt, deposited under GenBank accssion number MZ355624) was identified as strawberry polerovirus 1 (SPV-1). A total of 10,401 reads was mapped to the reference SPV-1 nucleotide genome (GenBank accession number NC_025435) with a 263.2 sequence depth. The contig shared 99% nt sequence identity with SPV-1 isolate AB5301 (GenBank accession number KM233705) from Canada and 97% identity with the Argentine SPV-1 isolate 15CA (GenBank accession number MK142237). To confirm the presence of SPV-1, reverse transcription-PCR (RT-PCR) was performed using previously reported specific primers, SPV-1F (AGAGATCGCCGGATTCCGCAA) and SPV-1R (TGACACGCTCGGTATTCACAAACAG), amplifying 281 nt of the P1-P2 fusion protein gene (Thekke-Veetil and Tzanetakis 2016). Of the three samples, only one showing vein banding symptoms (Figure S1) was positive for SPV-1. Sanger sequencing of the RT-PCR products showed 100% nt identity with the HTS-derived sequence. SPV-1, a member of the genus Polerovirus in the family Solemoviridae, was first reported in strawberry showing decline symptom in Canada (Xiang et al. 2015), and was subsequently detected in the USA (Thekke-Veetil and Tzanetakis 2016) and in Argentina (Luciani et al. 2016; 2018). To our knowledge, this is the first report of SPV-1 infection in strawberry in Nepal and Asia.