Prolactin (PRL) has been reported to influence reproductive performance and cell apoptosis. However, its mechanism remains unclear. Hence, in the present study, ovine ovarian granulosa cells (GCs) were used as a cell model to investigate the relationship between PRL concentration and GC apoptosis, as well as its possible mechanisms. We examined the relationship between serum PRL concentration and follicle counts in sexually mature ewes. GCs were isolated from adult ewes and treated with different concentrations of PRL, while 500 ng/mL PRL was selected as the high concentration of prolactin (HPC). Then, we applied the transcriptome sequencing (RNA-Seq) combined with a gene editing approach to explore the HPC contributing to cell apoptosis and steroid hormones. The apoptosis of GCs gradually increased at PRL concentrations above 20 ng/mL, while 500 ng/mL PRL significantly decreased the secretion of steroid hormones and the expression of L-PRLR and S-PRLR. The results indicated that PRL regulates GC development and steroid hormones mainly through the target gene MAPK12. The expression of MAPK12 was increased after knocked-down L-PRLR and S-PRLR, while it decreased after overexpressed L-PRLR and S-PRLR. Cell apoptosis was inhibited and the secretion of steroid hormones increased after interfering with MAPK12, while the overexpression of MAPK12 showed the opposite trend. Overall, the number of follicles gradually decreased with increasing PRL concentration. HPCs promoted apoptosis and inhibited steroid hormone secretion in GCs by upregulating MAPK12 through reducing L-PRLR and S-PRLR.

Long non-coding RNAs (lncRNAs) have been shown to play important roles in livestock fecundity, and many lncRNAs that affect follicular development and reproductive diseases have been identified in the ovary. However, only a few of them have been functionally annotated and mechanistically validated. In this study, we identified a new lncRNA (lncGSAR) and investigated its effects on the proliferation and steroidogenesis of ovine granulosa cells (GCs). High concentrations of glucose (add 33.6 mM glucose) caused high expression of lncGSAR in GCs by regulating its stability, and lncGSAR overexpression promoted GCs proliferation, estrogen secretion, and inhibited progesterone secretion, whereas interference with lncGASR had the opposite effect. Next, we found that the RNA molecules of lncGSAR act on MiR-125b as competitive endogenous RNA (ceRNA), and SREBP-cleavage-activating protein (SCAP) was verified as a target of MiR-125b. LncGASR overexpression increased the expression of SCAP, SREBP, and steroid hormone-related proteins, which can be attenuated by MiR-125b. Our results demonstrated that lncGSAR can act as a ceRNA to activate SCAP/SREBP signaling by sponging MiR-125b to regulate steroid hormone secretion in GCs. These findings provide new insights into the mechanisms of nutrient-regulated follicle development in ewes.

High prolactin (PRL) concentration has been shown to induce the apoptosis of ovine ovarian granulosa cells (GCs), but the underlying mechanisms are unclear. This study aimed to investigate the mechanism of apoptosis induced by high PRL concentration in GCs. Trial 1: The optimal concentration of glutathion was determined according to the detected cell proliferation. The results showed that the optimal glutathione concentration was 5 μmol/mL. Trial 2: 500 ng/mL PRL was chosen as the high PRL concentration. The GCs were treated with 0 ng/mL PRL (C group), 500 ng/mL PRL (P group) or 500 ng/mL PRL, and 5 μmol/mL glutathione (P-GSH group). The results indicated that the mitochondrial respiratory chain complex (MRCC) I–V, ATP production, total antioxidant capacity (T-AOC), superoxide dismutase (SOD), and thioredoxin peroxidase (TPx) in the C group were higher than those in the P group (p < 0.05), while they were lower than those in the P-GSH group (p < 0.05). Compared to the C group, the P group exhibited elevated levels of reactive oxygen species (ROS) and apoptosis (p < 0.05) and increased expression of ATG7 and ATG5 (p < 0.05). However, MRCC I–V, ATP, SOD, A-TOC, TPx, ROS, and apoptosis were decreased after the addition of glutathione (p < 0.05). The knockdown of either L-PRLR or S-PRLR in P group GCs resulted in a significant reduction (p < 0.05) in MRCC I–V, ATP, T-AOC, SOD and TPx, while the overexpression of either receptor showed an opposite trend (p < 0.05). Our findings suggest that high PRL concentrations induce apoptotic cell death in ovine ovarian GCs by downregulating L-PRLR and S-PRLR, activating oxidative stress and autophagic pathways.

Short-term dietary supplementation of ewes during the luteal phase can increase fertility, most probably by stimulating glucose uptake by the follicles. However, the molecular mechanism of glucose regulation of follicular development has not yet been clarified, especially the further study of long non-coding RNA (lncRNA) in determining fertility during follicular development. We generated granulosa cell (GC) models of different doses of glucose (0, 2.1, 4.2, 8.4, 16.8 and 33.6 mM), and observed that the highest cell viability was recorded in the 8.4 mM group and the highest apoptosis rates were recorded in the 33.6 mM group. Therefore, a control group (n = 3, 0 mM glucose), a low glucose group (n = 3, add 8.4 mM glucose), and a high glucose group (n = 3, add 33.6 mM glucose) of GCs were created for next whole genomic RNA sequencing. In total, 18,172 novel lncRNAs and 510 annotated lncRNAs were identified in the GCs samples. Gene Ontology indicated that differentially expressed lncRNAs associated with cell apoptosis were highly enriched. Kyoto Encyclopedia of Genes and Genomes enrichment analysis of lncRNA target genes found that the apoptosis pathway and the p53 signaling pathway were both enriched. Furthermore, we focused on the function of a lncGDAR and verified that lncGDAR could influence cell apoptosis in GC development through affecting the mRNA and protein expression of apoptosis-related markers. These results provide the basis for further study of the lncRNA regulation mechanism in nutrition on female fertility.

Changes in physiological and biochemical parameters are crucial for the reproductive performance and health of perinatal ewes. This study investigated the temporal variations in feed intake, nutrient digestibility, serum parameters, and ruminal fermentation on days 21, 14, and 7 before lambing (Q21, Q14, and Q7) and days 3, 7, and 14 after lambing (H3, H7, and H14). The results showed that dry matter intake (DMI) and glucose (Glu) gradually decreased (p < 0.05) before lambing and increased (p < 0.05) after lambing. The digestibility of dry matter (DMD), crude protein (CPD), and acid detergent fiber (ADFD) increased (p < 0.05) before lambing, then decreased (p < 0.05) on day H3, and then increased (p < 0.05) on day H14. The rumen pH, NH₃-N, and triglycerides (TG) gradually increased (p < 0.05) before lambing and were higher (p < 0.05) on day Q7 than after lambing. The concentrations of acetate, butyrate, and total volatile fatty acids (T-VFA) were lower (p < 0.05) on day Q7 than those on days Q21 and Q14, then increased (p < 0.05) after lambing. Total cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) concentrations gradually decreased (p < 0.05) in perinatal ewes. BHBA and NEFA concentrations were lower (p < 0.05) on day Q21 than those from days Q14 to H14. The rumen microbiota compositions were different (p < 0.05) in perinatal ewes, and g_Anaerovibrio, g_Lachnobacterium, and g_Schwartzia were positively correlated (p < 0.05) with DMI, Glu, acetate, propionate, and T-VFA, and negatively correlated (p < 0.05) with LDL-C. g_Bacillus was negatively correlated (p < 0.05) with DMI, Glu, acetate, propionate, butyrate, and T-VFA, but positively correlated (p < 0.05) with rumen pH and LDL-C. In summary, the DMI, nutrient digestibility, rumen fermentation, and serum parameters changed during the perinatal period of ewes, and the changes in DMI, serum glucose, acetate, propionate, and T-VFA were related to the rumen bacteria.

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1.