High prolactin (PRL) concentration has been shown to induce the apoptosis of ovine ovarian granulosa cells (GCs), but the underlying mechanisms are unclear. This study aimed to investigate the mechanism of apoptosis induced by high PRL concentration in GCs. Trial 1: The optimal concentration of glutathion was determined according to the detected cell proliferation. The results showed that the optimal glutathione concentration was 5 μmol/mL. Trial 2: 500 ng/mL PRL was chosen as the high PRL concentration. The GCs were treated with 0 ng/mL PRL (C group), 500 ng/mL PRL (P group) or 500 ng/mL PRL, and 5 μmol/mL glutathione (P-GSH group). The results indicated that the mitochondrial respiratory chain complex (MRCC) I–V, ATP production, total antioxidant capacity (T-AOC), superoxide dismutase (SOD), and thioredoxin peroxidase (TPx) in the C group were higher than those in the P group (p < 0.05), while they were lower than those in the P-GSH group (p < 0.05). Compared to the C group, the P group exhibited elevated levels of reactive oxygen species (ROS) and apoptosis (p < 0.05) and increased expression of ATG7 and ATG5 (p < 0.05). However, MRCC I–V, ATP, SOD, A-TOC, TPx, ROS, and apoptosis were decreased after the addition of glutathione (p < 0.05). The knockdown of either L-PRLR or S-PRLR in P group GCs resulted in a significant reduction (p < 0.05) in MRCC I–V, ATP, T-AOC, SOD and TPx, while the overexpression of either receptor showed an opposite trend (p < 0.05). Our findings suggest that high PRL concentrations induce apoptotic cell death in ovine ovarian GCs by downregulating L-PRLR and S-PRLR, activating oxidative stress and autophagic pathways.

The glucose metabolism homeostasis in the follicular fluid microenvironment plays an important role in follicular maturation and ovulation, and excessively high or low glucose concentrations have adverse effects on the differentiation of follicular granulosa cells (GCs). However, a limited number of microRNAs (miRNA) have been reported to be involved in glucose-stimulated GCs differentiation. In this study, we characterized the miRNA expression profiles of sheep ovarian GCs cultured in high-glucose and optimal glucose concentrations and focused on a differentially expressed miRNA: miR-17-5p, which may be involved in regulating high-glucose-induced GC apoptosis by targeting KPNA2. We found that overexpression of miR-17-5p significantly promoted GCs proliferation and inhibited cell apoptosis, while downregulated the mRNA and protein expression of apoptosis-related makers (Bax, Caspase-3, Caspase-9, and Bcl-2). In contrast to the classical mechanism of miRNA silencing target gene expression, miR-17-5p overexpression significantly upregulated the expression of target gene KPNA2. A dual luciferase reporter gene assay verified the targeted binding relationship between miR-17-5p and KPNA2 promoter. Meanwhile, overexpression of KPNA2 further promoted the downregulation of apoptosis-related genes driven by miR-17-5p mimics. Knockdown of KPNA2 blocked the inhibitory effect of miR-17-5p mimics on the expression of apoptosis-related genes. Our results demonstrated that miR-17-5p activated the KPNA2 promoter region and upregulated KPNA2 expression, thereby inhibiting GCs apoptosis under high glucose.

Prolactin (PRL) plays an important role in animal follicle development and ovulation. However, its regulatory effects on the different stages of the estrus cycle in ewes are unclear. In this study, bromocriptine (BCR, PRL inhibitor) was used to study the effect of PRL on the secretion of reproductive hormones and gene expressions in order to explore its regulatory effects on the sexual cycle of ewes. Eighty healthy ewes with the same parity and similar weights were randomly assigned to the control group (C, n = 40) and the treatment group (T, n = 40, fed bromocriptine). After estrus synchronization, thirty-one ewes with overt signs of estrus were selected from each group. Six blood samples were randomly obtained by jugular venipuncture to measure the concentration of PRL, estrogen (E₂), progesterone (P₄), luteinizing hormone (LH), follicle-stimulating hormone (FSH), and gonadotropin-releasing hormone (GnRH) in the proestrus, estrus, metestrus, and diestrus. At the same time, we collected the ovaries of the six ewes in vivo after anesthesia in order to detect follicle and corpus luteum (CL) counts and measure the expression of hormone-receptor and apoptosis-related genes. The results show that PRL inhibition had no significant effects on the length of the estrus cycle (p > 0.05). In proestrus, the number of large and small follicles, the levels of E₂, FSH, and GnRH, and the expressions of ER, FSHR, and the apoptotic gene Caspase-3 were increased (p < 0.05); and the number of middle follicles and the expression of anti-apoptotic gene Bcl-2 were decreased (p < 0.05) in the T group. In estrus, the number of large follicles, the levels of E₂ and GnRH, and the expressions of the StAR, CYP19A1, and Bcl-2 genes were increased (p < 0.05), and the number of middle follicles was decreased (p < 0.05) in the T group. In metestrus, the number of small follicles and the expression of LHR (p < 0.05) and the pro-apoptotic gene Bax were increased (p < 0.05); the number of middle follicles was decreased (p < 0.05) in the T group. In diestrus, the number of large follicles, middle follicles, and CL, the level of P₄, and the expressions of PR, 3β-HSD, StAR, Caspase-3, and Bax were increased (p < 0.05); the number of small follicles and the expression of Bcl-2 were decreased (p < 0.05) in the T group. In summary, PRL inhibition can affect the secretion of reproductive hormones, the follicle count, and the gene expression during the estrus cycle. These results provide a basis for understanding the mechanisms underlying the regulation of the ewe estrus cycle by PRL.

The objective of this study was to investigate the differences in the energy metabolites, immunity, antioxidant capacity, and rumen microbiota of ewes with different numbers of fetuses. Thirty healthy ewes were selected and divided into single- (SL, n = 10), twin- (TL, n = 10), and triplet-fetal (PL, n = 10) ewes according to the number of fetuses. Sampling was carried out on days 21 (Q21) and 7 (Q7) before lambing. The results show no differences (p > 0.05) in the DMI and BW of ewes with different numbers of fetuses, and the body condition score (BCS) of PL ewes was lower (p < 0.05) than that of SL ewes. The concentrations of β-hydroxybutyric acid (BHBA), non-esterified fatty acids (NEFA), interleukin-2 (IL-2), interleukin-6 (IL-6), and tumor necrosis factor α (TNF-α) in the PL ewes were higher (p < 0.05), while the glucose (Glu), triglyceride (TG), total cholesterol (TC), superoxide dismutase (SOD), glutathione peroxidase (GSH-Px), and total antioxidant capacity (T-AOC) values were lower (p < 0.05) than those of the SL ewes. ANOSIM analysis showed that the rumen bacterial structure of the SL, TL, and PL ewes was different on days Q21 and Q7. The relative abundance of Firmicutes and Bacteroidota in the rumen was affected (p < 0.05) by the number of fetuses: the relative abundance of Firmicutes (Ruminococcus, Butyrivibrio, Christensenellaceae_R-7_group, Lachnospiraceae_AC2044_group, Lachnospiraceae_XPB1014_group, and Anaeroplasma) was higher (p < 0.05), while that of Bacteroidota (Prevotella, Prevotellaceae_UCG-003, and Prevotellaceae_UCG-001) was lower (p < 0.05) in the SL ewes than in the PL ewes. In summary, the rumen microbial structure and energy metabolites of ewes in late gestation with different numbers of fetuses were different. Triplet-fetal ewes were characterized by lower BCS and antioxidant capacity and were prone to the triggering of inflammatory responses.

High concentrations of prolactin (PRL)-induced ovine ovarian granulosa cell (GCs) apoptosis and MAPK12 could aggravate the induced effect. However, the molecular mechanisms that MAPK12-induced GC apoptosis and repressed steroid hormone secretion remain unclear. In this study, GCs in the P group (GCs with high PRL concentration: 500 ng/mL PRL) and P-10 group (GCs with 500 ng/mL PRL infected by lentiviruses carrying overexpressed sequences of MAPK12) were collected for whole-transcriptome analysis. Then, we applied the miRNA mimics combined with a dual-luciferase reporter gene assay to explore the molecular mechanisms through which MAPK12 affected GC apoptosis and steroid hormones secretion. The whole-transcriptome analysis indicated that MAPK12 regulated high PRL concentration GC apoptosis and steroid hormone secretion mainly through novel 58. The expression of pro-apoptotic proteins Caspase 3 and Bax was increased, while the expression of anti-apoptotic protein BCL-2 declined by novel 58-5p in high PRL concentration GCs (p < 0.05); The secretion of steroid hormones and genes associated with steroid secretion (CYP11A1, 3β-HSD and CYP19A1) decreased (p < 0.05), while the protein expression of the target gene, SREBF1 of novel 58, was repressed by novel 58-5p in high PRL concentration GCs (p < 0.05). Dual-luciferase reporter gene analysis showed that SREBF1 was confirmed as a target gene of novel 58-5p and the negative feedback interaction was established between novel 58-5p and SREBF1. The ggccggctgggggattgccg sequence may be the target site of SREBF1, targeted by novel 58-5p. In addition, steroid hormone secretion was reduced and GC apoptosis was suppressed after the interference of SREBF1 in ovine ovarian GCs with high PRL concentration. In conclusion, novel 58-5p regulated ovine ovarian GC apoptosis and steroid hormone secretion by targeting SREBF1.

Prolactin (PRL) plays a key role in the growth and ovulation of animal follicles, but its impact on follicular recruitment in ewes remains uncertain. In this study, a total of sixteen healthy ewes (Hu sheep, aged 2–3 years, with continuous reproduction and housed separately), matched for parity and weight (52.98 ± 0.96 kg), were randomly assigned to two groups: a control group (C) and a treatment group (T, PRL inhibition). Ovaries were collected in vivo after anesthesia during the estrus stage, and tissue morphology was observed using hematoxylin–eosin (HE) staining. By using RNA sequencing on the ovaries of C and T groups and conducting bioinformatics analysis, the essential genes and pathways involved in the regulation of PRL inhibition were pinpointed. Subcellular localization of key genes in ovarian tissue was determined using a fluorescence in situ hybridization (FISH) assay and immunohistochemistry. The function of key genes was validated using knockout and overexpression techniques. During the estrus phase, we noted a marked rise in the count of large follicles within ovarian tissue following the inhibition of prolactin. In total, 328 differentially expressed genes (DEGs) were detected, with 162 upregulated and 166 downregulated. The results indicated that inhibiting PRL primarily influences follicle recruitment by acting on the target gene PIKfyve. Following the inhibition of PRL during the estrus phase, there was an increase in the expression of PIKfyve. PIKfyve was primarily localized in the ovarian granulosa cells (GCs) and cumulus cells (CCs) in the ovarian tissue of ewes. The overexpression of PIKfyve decreased cell apoptosis and enhanced steroid hormone release, whereas knockout of PIKfyve had the reverse effect. In conclusion, PRL inhibition promoted follicle recruitment in ewes by upregulating PIKfyve during the estrus stage.