Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Potato (Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In...

Charcoal rot, caused by Macrophomina phaseolina, is an important disease in tropical and subtropical regions which affects a broad range of host plants, including potato (Solanum tuberosum L.). In ...

Blackberries (Rubus L. subgenus Rubus Watson) are popular, wild fruits with high content of antioxidants and thus with beneficial effect on the human health (Reyes-Carmona et al. 2005). In July 201...

Sclerotinia sclerotiorum is a globally distributed necrotrophic pathogen with a broad host range, including many Brassicaceae crops. In 2021, white rot symptoms on cabbage were observed in 12 commercial fields in the northern part of Serbia. Twelve representative isolates of S. sclerotiorum, forming white colonies and black sclerotia, were selected for characterization and comparison with an isolate from sunflower, as the most important host plant in Serbia. The isolates showed significant variation in growth rate and sclerotia production, while ITS sequence analysis revealed the complete nucleotide identity and all isolates grouped within the major phylogenetic clade of S. sclerotiorum. Despite the low diversity of the global population of S. sclerotiorum, forty-four haplotypes were identified, with one predominant haplotype encompassing all Serbian isolates. When six Brassicaceae species (cabbage, cauliflower, broccoli, kale, mustard, and oilseed rape) and sunflower were inoculated, sunflower was found to be the most and cauliflower the least susceptible, while isolates from cabbage were generally more aggressive than those derived from sunflower. This work represents the first detailed characterization of S. sclerotiorum infecting cabbage in Serbia and highlights its genetic uniformity and differential pathogenic potential, which are critical factors for integrated disease management and crop rotation planning in Brassicaceae agroecosystems.

Tomatoes (Solanum lycopersicum) represent one of the most frequently consumed vegetables in Mauritius after potatoes and onions. The value of the tomato industry is estimated to be around Rs 300 M ...