A phytochemical and biological investigation of the endemic Mascarene Aloes (Aloe spp.), including A. tormentorii (Marais) L.E.Newton & G.D.Rowley, A. purpurea Lam, A. macra Haw., A. lomatophylloides Balf.f and A. vera (synonym A. barbadensis Mill.), which are used in the traditional folk medicine of the Mascarene Islands, was initiated. Methanolic extracts of the Aloes under study were analysed using high resolution LC-UV-MS/MS and compounds belonging to the class of anthraquinones, anthrones, chromones and flavone C-glycosides were detected. The Mascarene Aloes could be distinguished from A. vera by the absence of 2″-O-feruloylaloesin and 7-O-methylaloeresin. GC-MS analysis of monosaccharides revealed the presence of arabinose, fucose, xylose, mannose and galactose in all the Mascarene Aloes and in A. vera. The crude extracts of all Aloes analysed displayed antimicrobial activity against Bacillus cereus, Staphylococcus aureus, Escherichia coli and Pseudomonas aeruginosa. Only extracts of A. macra were active against P. aeruginosa and Klebsiella pneumoniae, while none of the Aloe extracts inhibited Propionibacterium acnes. A. macra displayed anti-tyrosinase activity, exhibiting 50% inhibition at 0.95mg/mL, and extracts of A. purpurea (Mauritius) and A. vera displayed activity in a wound healing-scratch assay. In vitro cytotoxicity screening of crude methanolic extracts of the Aloes, using the MTT (3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide) showed that only A. purpurea (Réunion) elicited a modest toxic effect against HL60 cells, with a percentage toxicity of 8.2% (A. purpurea-Réunion) and none of the Aloe extracts elicited a toxic effect against MRC 5 fibroblast cells at a concentration of 0.1mg/mL. Mascarene Aloe species possess noteworthy pharmacological attributes associated with their rich phytochemical profiles.

Until now, the Mauritian endemic fruit Tambourissa ficus of the Monimiaceae family has remained unexplored. The study’s goal was to look into the phytochemical composition and antioxidant properties of different solvent extracts of the fruit. The presence of phenolics, flavonoids, terpenes, coumarins, alkaloids, and tannins was discovered through qualitative screening. The highest total polyphenol content (TPC = 9.78 ± 0.18 mg GAE/g dw) and the highest total flavonoid content (TFC = 8.84 ± 0.07 mg QE/g dw) was observed in ethanolic extract, while the highest total terpenoid content (TTC = 587.9 ± 0.72 mg linalool/g dw) was found in the acetone extract. The antioxidant activity vs. ABTS was the highest (4.71 ± 0.18 mg TE/g dw) in the ethanol extract. All three groups—TPC, TFC, and TTC revealed a moderate correlation with ABTS antioxidant activity, being 0.754, 0.778, and 0.774 on average, respectively. Ultraviolet–visible (UV-Vis) spectroscopy spectrophotometry and Fourier transform infrared spectroscopy (FTIR) spectroscopy confirmed the presence of polyphenolic compounds. Individual noteworthy phytochemicals, including the alkaloids chelidonine, protopine, and brevicarine, which are potential antioxidant compounds, were also discovered in the fruit through liquid chromatography–mass spectrometry (LC-MS) screening. The overall antioxidant activity of the fruit can, therefore, be attributed to the synergistic effects of the multiple chemical components in the extracts.

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. 'Elpida' located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive "ghost spot" was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. 'Elpida' with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch's postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

Potato (Solanum tuberosum L.) is considered as one of the most economically important non-sugar food crops in Mauritius, with annual production of over 14,000 tonnes (Statistics Mauritius 2018). In...

Charcoal rot, caused by Macrophomina phaseolina, is an important disease in tropical and subtropical regions which affects a broad range of host plants, including potato (Solanum tuberosum L.). In ...