Ear rot is one of the most prevalent and destructive diseases of maize. During field surveys, it was found that a Penicillium ear rot broke out in some areas of Shanxi, Shaanxi, Hebei, and Tianjin in China, with an incidence of 3 to 90%. A Penicillium sp. was isolated from diseased kernels covered with greyish green mold, and three isolates were identified by morphologic and molecular characteristics. The pathogenicity of isolate ZBS205 to maize ears was further determined by artificial inoculation in a field. Furthermore, the sensitivity of isolate ZBS205 against six commonly used fungicides was also evaluated. According to macro- and micromorphologic characteristics, isolate ZBS205 was generally identical to Talaromyces funiculosus (teleomorph of Penicillium funiculosum). The partial gene sequences of the nuclear ribosomal ITS1-5.8S-ITS2 (ITS) region, β-tubulin, putative ribosome biogenesis protein (Tsr1), and the second largest subunit of the RNA polymerase II (RPB2) from isolates ZBS205, D49-1, and S73-1 showed the highest nucleotide identity to T. funiculosus strain X33, and the phylogenetic analysis conducted by the neighbor-joining method with the combined data of the four genes demonstrated that these three isolates clustered with T. funiculosus strain X33. These results suggested that the fungus isolated from diseased maize kernels was T. funiculosus. Pathogenicity testing showed that the T. funiculosus isolate ZBS205 was pathogenic to maize ears, which showed symptoms of rotted cob and deteriorated kernels. This is the first report of T. funiculosus as the definitive pathogen causing maize ear rot. The result of fungal sensitivity against fungicides showed that pyraclostrobin exhibited the highest toxicity to mycelial growth and could be used as a candidate agent for the prevention and control of T. funiculosus ear rot. The results of the present study provide a basis for understanding ear rot caused by T. funiculosus, and they should play an important role in disease management.

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Maize (Zea mays L.) is one of three major grain crops in China, with production reaching 261 million tons in 2019(NBS, 2020). Some fungi cause maize ear rot which lead to significant yield and quality losses. In 2016, about 5% of maize ears were dark brown and covered with a white mould in seed production fields in Lingshui, Hainan Province, China. These ears were brought back to the laboratory for analysis. Molded kernels were surface sterilized in 75% ethanol for 3 min and in 10% sodium hypochlorite for 3 min, subsequently rinsed three times in sterile-distilled water, placed onto potato dextrose agar (PDA), and incubated at 28°C in the dark for 3 days. mycelia tips grown from kernels were transferred into fresh PDA plates. Seven fungal isolates with similar morphology characteristics were obtained, and three of them were identified by morphology and molecular identification. The colonies grew rapidly. The aerial mycelia turned white to black with age. Conidia were straight to slightly curved, oval, pyriform or geniculate, brown to dark brown, and had 2 to 7 septa, with both basal and caudal septa thicker and darker than others, 39.47 to 78.66 ×13.96 to 22.78 μm, with a distinctly protruding hilum swelled from the basal cell. Conidiophores were dark brown, with geniculate tip and many septa. For molecular identification, genomic DNA of isolate was extracted from mycelia. The internal transcribed spacer (ITS), 1,3,8-trihydroxynaphthalene reductase (Brn) and glyceraldehyde-3-phosphate dehydrogenase-like (Gpd) genes were amplified with primers ITS1/ITS4 (White et al. 1990), Brn01/Brn02 (Shimizu et al. 1998) and gpd1/gpd 2 (Berbee et al. 1999) , respectively. BLASTn analysis showed that high identities with Exserohilum rostratum (ITS, LT837845.1, 100%; Brn, AY621165.1, 99.87%; Gpd, LT882543.1, 99.75%). Sequences of ITS, Brn and Gpd were deposited in GenBank with accession numbers MW362495, MW363953 and MW363954, respectively. Based on morphological characteristics and molecular analysis, the isolate was identified as E. rostratum (Hernández-Restrepo et al. 2018). Koch's postulates were completed by using ears of maize inbred line Huangzaosi and Chang7-2 growing in the experimental field of Baoding, Hebei Province. Three days post-silk emergence, each of the four maize ears was injected with 2 ml conidial suspension (1×106 conidia/ml) of isolate ZBSF005 through the silk channel. In the control groups, three ears were inoculated with an equal amount of sterile-distilled water. The inoculated ears grew under natural conditions for 30 days, the diseased kernels and ear tips were black brown and the surface covered with white or gray black mildew layer. The kernels with severe infection were wizened. But the bract could not be infected by the pathogen. Meanwhile, the control remained asymptomatic. The same fungus was successfully re-isolated from the inoculated kernels, and its identity was confirmed by morphological and molecular biology approaches, thus fulfilling Koch's postulates. E. rostratum has been reported to cause leaf spots in a wide range of hosts, such as Calathea picturata, Lagenaria siceraria, Saccharum officinarum, Ananas comosus, Hevea brasiliensis, Zea mays and so on (Chern et al. 2011; Ahmadpour et al. 2013; Choudhary et al. 2018), and it was also reported to cause root rot in Lactuca saliva (Saad et al. 2019). To our knowledge, this is the first report of E. rostratum causing maize ear rot in China. The pathogen was simultaneously inoculated to 8 maize inbred lines in Hebei province, but the disease only occurred in some varieties and the incidence area was large. Therefore, attention should be paid to the prevention and treatment of ear rot caused by this pathogen in the breeding process.

Highly sensitive methods for trace-level aflatoxin determination are indispensable for cereal food safety and public health protection. This study developed a ZrO₂-assisted QuEChERS-UHPLC-MS/MS method for the simultaneous determination of AFB₁, AFB₂, AFG₁, and AFG₂ in maize, wheat, rice, and soybean. Systematic optimization identified acetonitrile as the optimal extraction solvent and 10 mg ZrO₂ in combination with PSA, C₁₈, and GCB as the optimal cleanup formulation, providing recoveries of 107.33–111.60%. Chromatographic baseline separation was achieved within 8.0 min using a moderate gradient program. The method exhibited excellent linearity (R² > 0.999) with LODs of 0.15–0.25 µg/kg and LOQs of 0.50–0.75 µg/kg. Negligible matrix effects (0.85–1.02) validated the efficacy of ZrO₂-assisted cleanup in eliminating co-extractive interferences in maize. Satisfactory accuracy (recoveries of 86.66–111.04%) and precision (RSDs < 14%) were obtained across all matrices. The method demonstrated consistent performance across diverse cereal and soybean matrices, fulfilling international regulatory requirements for routine aflatoxin monitoring in agricultural commodities.

This study clarified the field control efficacy, yield regulation effect and action mechanism of 40% cyproconazole suspension concentrate (SC) against southern corn rust caused by Puccinia polysora, aiming to provide scientific support for its registration, extension and field application. Indoor toxicity was assayed using urediniospore germination and germ tube elongation inhibition combined with seedling pot tests and field efficacy trials. Wheat germ agglutinin staining was applied to observe the pathogen infection process. Cyproconazole showed strong inhibition on spore germination and germ tube elongation, with EC₅₀ values of 70.455 mg·L⁻¹ and 21.686 mg·L⁻¹. On corn seedlings, its protective and curative control efficacies reached 91.11% and 82.19%. At 45 days after application during ear maturity, the field protective and curative efficacies were 65.93–78.38% and 69.26–80.79%, respectively. Notably, the integrated control strategy with two applications achieved even higher efficacy, ranging from 73.33% to 86.80%, and a yield loss recovery rate of 54.09–54.51%, both of which were superior to those of the conventional fungicide pyraclostrobin·epoxiconazole SC. Using WGA fluorescence staining, fluorescence microscopy directly visualized that the fungicide suppressed infection by inhibiting spore germination, germ tube elongation and appressorium formation. In summary, 40% cyproconazole SC has prominent persistent control efficacy and a yield-improving effect with a definite action mechanism, which is worthy of accelerated registration and popularization for southern corn rust management.

Southern corn rust, caused by Puccinia polysora Underw, is a major foliar disease that threatens corn yield in China. Detection of P. polysora during the corn growing period is critical for timely intervention and disease management. In this study, specific primers and probes were designed based on the variable region of the rDNA-ITS sequence. After conventional PCR validation, specificity screening, and sensitivity evaluation, an optimal primer–probe combination was successfully established. The developed assay achieved a detection limit of 1 pg·μL⁻¹ genomic DNA and a DNA equivalent of 57.6 urediniospores of P. polysora. The reaction conditions were further optimized, and stable amplification could be completed under a constant temperature of 38 °C for 15 min. The developed MIRA-LFIA was evaluated using 70 field maize leaf samples, with the reported OTNPCR (One-Tube-Nested PCR) method used as the gold-standard reference. MIRA-LFIA produced 55 positive and 15 negative results, whereas OTNPCR yielded 57 positive and 13 negative samples. A diagnostic evaluation revealed that the MIRA-LFIA assay achieved a sensitivity of 96.49%, specificity of 100%, positive predictive value of 100%, negative predictive value of 86.67%, and Youden’s index of 0.965., with a Kappa value of 0.911. This MIRA-LFIA system enables rapid detection and visual interpretation of southern corn rust. It features simple operation and low technical requirements, making it suitable for rapid on-site monitoring at grassroots institutions and in fields.