Field trials based on manual infestation of the Asian corn borer (ACB) (Ostrinia furnacalis [Guenée]) and Fusarium verticillioides (Nirenberg) atomization were conducted on four maize hybrids to investigate the relationship between ACB infestation and F. verticillioides infection, yield loss, and fumonisin contamination in maize. Analysis of fumonisins B1 and B2 was carried out using an LC-MS/MS system. In this study, manual ACB infestation significantly promoted F. verticillioides infection (both symptomatic and symptomless) and grain fumonisin levels. Ear rot incidence and severity, symptomless kernel infection, and fumonisin contamination were significantly correlated to each other and to ACB damage severity. Manual ACB infestation increased fumonisin levels from 580 to 4,418 µg/kg in 2018; 6,059 to 10,681 µg/kg in 2019 spring-sown maize (2019A); and 2,042 to 5,060 µg/kg in 2019 summer-sown maize (2019B), with the threshold of the European Union (EU) being 4,000 µg/kg. The threshold was exceeded in spring of 2019 in untreated controls. Regarding yield, significant negative correlation between ACB damage and ear weight was observed in three seasons. These results indicated that ACB infestation can lead to severe quality degradation and yield loss of maize. Kernel fumonisin levels may exceed the concentration threshold of the EU in certain conditions, threatening the health of livestock and humans. Measures should be taken to reduce ACB infestation to ensure food and feed security.

Ear rot is one of the most prevalent and destructive diseases of maize. During field surveys, it was found that a Penicillium ear rot broke out in some areas of Shanxi, Shaanxi, Hebei, and Tianjin in China, with an incidence of 3 to 90%. A Penicillium sp. was isolated from diseased kernels covered with greyish green mold, and three isolates were identified by morphologic and molecular characteristics. The pathogenicity of isolate ZBS205 to maize ears was further determined by artificial inoculation in a field. Furthermore, the sensitivity of isolate ZBS205 against six commonly used fungicides was also evaluated. According to macro- and micromorphologic characteristics, isolate ZBS205 was generally identical to Talaromyces funiculosus (teleomorph of Penicillium funiculosum). The partial gene sequences of the nuclear ribosomal ITS1-5.8S-ITS2 (ITS) region, β-tubulin, putative ribosome biogenesis protein (Tsr1), and the second largest subunit of the RNA polymerase II (RPB2) from isolates ZBS205, D49-1, and S73-1 showed the highest nucleotide identity to T. funiculosus strain X33, and the phylogenetic analysis conducted by the neighbor-joining method with the combined data of the four genes demonstrated that these three isolates clustered with T. funiculosus strain X33. These results suggested that the fungus isolated from diseased maize kernels was T. funiculosus. Pathogenicity testing showed that the T. funiculosus isolate ZBS205 was pathogenic to maize ears, which showed symptoms of rotted cob and deteriorated kernels. This is the first report of T. funiculosus as the definitive pathogen causing maize ear rot. The result of fungal sensitivity against fungicides showed that pyraclostrobin exhibited the highest toxicity to mycelial growth and could be used as a candidate agent for the prevention and control of T. funiculosus ear rot. The results of the present study provide a basis for understanding ear rot caused by T. funiculosus, and they should play an important role in disease management.

Southern corn rust (SCR) caused by Puccinia polysora Underw. has recently emerged as a focal point of study because of its extensive distribution, significant damage, and high prevalence in maize growing areas such as the United States, Canada, and China. P. polysora is an obligate biotrophic fungal pathogen that cannot be cultured in vitro or genetically modified, thus complicating the study of the molecular bases of its pathogenicity. High temperatures and humid environmental conditions favor SCR development. In severe cases, SCR may inhibit photosynthesis and cause early desiccation of maize, a decrease in kernel weight, and yield loss. Consequently, an expedited and accurate detection approach for SCR is essential for plant protection and disease management. Significant progress has been made in elucidating the pathogenic mechanisms of P. polysora, identifying resistance genes and developing SCR-resistant cultivars. A detailed understanding of the molecular interactions between maize and P. polysora will facilitate the development of novel and effective approaches for controlling SCR. This review gives a concise overview of the biological characteristics and symptoms of SCR, its life cycle, the molecular basis of interactions between maize and P. polysora, the genetic resistance of maize to SCR, the network of maize resistance to P. polysora infection, SCR management, and future perspectives.

Maize (Zea mays L.) is one of the most important cereal crops in China, and the planting area reached 41.3 million hectares in 2019. Root rot is a widespread disease that occurs at the seedling stage of maize, resulting in leaf wilting, root rot and even plant death, and consequently yield and quality losses. During an investigation of spring maize in 2020, seedlings with wilted leaves and dark brown necrotic spots on root were observed in the fields in Kuancheng Manchu Autonomous County, Hebei Province, China. Symptomatic plants were collected for pathogen isolation and identification. The soil on roots was washed off with running water. Then, 2-3 mm necrotic root segments were sampled and surface sterilized with 75% ethanol for 2 min, rinsed three times with sterile distilled water, air-dried on sterile filter paper, and plated on potato dextrose agar (PDA). Plates were incubated at 28℃ in darkness for 3 days. A nonsporulating, dematiaceous fungus growing from root segments was transferred to fresh PDA plates. The colonies were round or irregular round, black, villiform with dense grayish white mycelia. Water agar amended with wheat straw was used for sporulation. Conidiophores were single, light brown, multiseptate, geniculate. Conidia were 38.68 x 10.69 to 71.98 x 20.57 μm, brown, oval, slightly curved, with 2 to 8 septa, and an obviously flattened hilum on the basal cell. Conidia germinated from both poles. The causal agent was identified as Bipolaris zeicola (G.L. Stout) Shoemaker (teleomorph = Cochliobolus carbonum R. R. Nelson) based on its morphological features. For molecular identification, genomic DNA was extracted from fresh mycelia cultured on PDA plates. Partial sequences of ITS-rDNA region and Brn1 reductase melanin biosynthesis gene were amplified using primers ITS1/ ITS4 (TCCGTAGGTGAACCTGCGG/ TCCTCCGCTTATTGATATGC) (White et al. 1990) and Brn01/ Brn02 (GCCAACATCGAGCAAACATGG/ GCAAGCAGCACCGTCAATACCAAT) (Shimizu et al. 1998), respectively. A DNA fragment of 532 bp was obtained from ITS-rDNA region and the sequence (GenBank Accession No. MW407046) was 100% identical to sequence of B. zeicola (GenBank Accession MH864760). The sequence of Brn1 gene was 816 bp (GenBank Accession No. MW415899) and was 99.75% identical to sequence of C. carbonum (GenBank Accession No. AB011658). The morphological and molecular evidence proved that the causal agent isolated from maize roots in Hebei province was B. zeicola. Pathogenicity assays were conducted with one week old (V1 stage) maize seedlings grown from the surface-sterilized seed of cv. Zhengdan 958. The mesocotyl and radicle of each plant (N=3) were inoculated with a 5 mm fungal disk of B. zeicola. Mock-inoculated plants (N=3) with sterile PDA disk served as the negative control. After 7 days, plants inoculated with B. zeicola were wilted with dark brown necrotic spots on mesocotyl and radicle. Meanwhile, the negative controls did not present any symptoms. Koch's postulate was proved with successful re-isolation of the same fungus from the inoculated maize plants. These results confirmed the pathogenicity of B. zeicola on maize root. B. zeicola mainly causes an important foliar disease in many regions of the world, known as Northern corn leaf spot, in addition, it can also cause ear rot and stalk rot of maize (Liu et al. 2015). To our knowledge, this is the first report of root rot caused by B. zeicola on maize in China, which extends the known agents of maize root rot. Therefore, it is necessary to explore effective seed-applied fungicides for disease control. Also, more attention should be paid to develop hybrids with resistance to this disease.

Wheat leaf rust fungus is an obligate parasitic fungus that can absorb nutrients from its host plant through haustoria and secrete effector proteins into host cells. The effector proteins are crucial factors for pathogenesis as well as targets for host disease resistance protein recognition. Exploring the role of effector proteins in the pathogenic process of Puccinia triticina Eriks. (Pt) is of great significance for unraveling its pathogenic mechanisms. We previously found that a cysteine-rich effector protein, Pt1641, is highly expressed during the interaction between wheat and Pt, but its specific role in pathogenesis remains unclear. Therefore, this study employed techniques such as heterologous expression, qRT-PCR analysis, and host-induced gene silencing (HIGS) to investigate the role of Pt1641 in the pathogenic process of Pt. The results indicate that Pt1641 is an effector protein with a secretory function and can inhibit BAX-induced programmed cell death in Nicotiana benthamiana. qRT-PCR analyses showed that expression levels of Pt1641 were different during the interaction between the high-virulence strain THTT and low-virulence strains FGD and Thatcher, respectively. The highest expression level in the low-virulence strain FGD was four times that of the high-virulence strain THTT. The overexpression of Pt1641 in wheat near-isogenic line TcLr1 induced callose deposition and H₂O₂ production on TcLr1. After silencing Pt1641 in the Pt low-virulence strain FGD on wheat near-isogenic line TcLr1, the pathogenic phenotype of Pt physiological race FGD on TcLr1 changed from “;” to “3”, indicating that Pt1641 plays a non-toxic function in the pathogenicity of FGD to TcLr1. This study helps to reveal the pathogenic mechanism of wheat leaf rust and provides important guidance for the mining and application of Pt avirulent genes.