Tomato is an important vegetable in the United States and around the world. Recently, tomato brown rugose fruit virus (ToBRFV), an emerging tobamovirus, has impacted tomato crops worldwide and can result in fruit loss. ToBRFV causes severe symptoms, such as mosaic, puckering, and necrotic lesions on leaves; other symptoms include brown rugose and marbling on fruits. More importantly, ToBRFV can overcome resistance in tomato cultivars carrying the Tm-2² locus. In this study, we recovered ToBRFV sequences from tomato seeds, leaves, and fruits from the U.S., Mexico, and Peru. Samples were pre-screened using a real-time RT-PCR assay prior to high-throughput sequencing. Virus draft genomes from 22 samples were assembled and analyzed against more than 120 publicly available genomes. Overall, most sequenced isolates were similar to each other and did not form a distinct population. Phylogenetic analysis revealed three clades within the ToBRFV population. Most of the isolates (95%) clustered in clade 3. Genetic analysis revealed differentiation between the three clades indicating minor divergence occurring. Overall, pairwise identity showed limited genetic diversity among the isolates in this study with worldwide isolates, with a pairwise identity ranging from 99.36% and 99.97%. The overall population is undergoing high gene flow and population expansion with strong negative selection pressure at all ToBRFV genes. Based on the results of this study, it is likely that the limited ToBRFV diversity is associated with the rapid movement and eradication of ToBRFV-infected material between countries.

Citrus yellow vein clearing virus is a previously reported citrus virus from Asia with widespread distribution in China. In 2022, the California Department of Food and Agriculture conducted a multipest citrus survey targeting multiple citrus pathogens including citrus yellow vein clearing virus (CYVCV). In March 2022, a lemon tree with symptoms of vein clearing, chlorosis, and mottling in a private garden in the city of Tulare, California, tested positive for CYVCV, which triggered an intensive survey in the surrounding areas. A total of 3,019 plant samples, including citrus and noncitrus species, were collected and tested for CYVCV using conventional reverse transcription polymerase chain reaction, reverse transcription quantitative polymerase chain reaction, and Sanger sequencing. Five hundred eighty-six citrus trees tested positive for CYVCV, including eight citrus species not previously recorded infected under field conditions. Comparative genomic studies were conducted using 17 complete viral genomes. Sequence analysis revealed two major phylogenetic groups. Known Asian isolates and five California isolates from this study made up the first group, whereas all other CYVCV isolates from California formed a second group, distinct from all worldwide isolates. Overall, the CYVCV population shows rapid expansion and high differentiation indicating a population bottleneck typical of a recent introduction into a new geographic area.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.

Passiflora edulis, commonly known as passion fruit, is a vine species of passionflower native to South America. In Colombia, yellow passion fruit (P. edulis f. flavicarpa) is the most important spe...

In Hawaii, passionfruit (Passiflora edulis; Passifloraceae) is grown primarily in residential properties and community gardens (CG). In 2019, passionfruit plants displaying chlorotic spots on young leaves, and green spots in senescing leaves were observed at two CG in Honolulu. Symptoms resembled those of passionfruit green spot virus (PfGSV) infection in Passiflora spp. (Ramos-González et al. 2020) and of the hibiscus strain of citrus leprosis virus C2 (CiLV-C2H) infection in hibiscus in Hawaii (Melzer et al. 2013). Both viruses belong to the genus Cilevirus, family Kitaviridae. Total RNA was extracted from two sample pools comprised of 40 symptomatic leaves collected from both the CG following a CTAB-based procedure (Li et al. 2008). To identify the virus associated with the P. edulis infection, reverse transcription (RT)-polymerase chain reaction (PCR) was performed using CiLV-C2 (Olmedo-Velarde et al. 2021) and PfGSV specific primers (Ramos-González et al. 2020). RT-PCR assay amplified the CiLV-C2 amplicon but failed to produce the PfGSV amplicon from infected leaves. Amplicon sequencing followed by a BLASTn search showed the nucleotide sequence had >99% identity with the CiLV-C2H-RNA1 (KC626783). A ribo-depleted RNA library created using the TruSeq Stranded Total RNA Library Prep kit (Illumina) underwent high throughput sequencing (HTS) on a NextSeq550 Illumina platform (2x75 cycles). The 6.5 million raw reads obtained were trimmed, filtered, and de novo assembled using Metaviral SPAdes v. 3.15.02 (Antipov et al. 2020). The resulting contigs were searched against an in-house database generated from GenBank virus and viroid sequences using BLASTn. This identified 12 and 3 contigs corresponding to CiLV-C2H and watermelon mosaic virus, respectively, with the latter being previously reported in passionfruit (Watanabe et al. 2016). RNA1 contigs covered 80.17% of the CiLV-C2H genome, whereas RNA2 contigs covered 94.5% with an average coverage depth of 31.660 and 57.121, respectively. To obtain the near complete genome of CiLV-C2H, gaps from the assembled HTS data were filled by overlapping RT-PCR followed by Sanger sequencing. RNA1 (8,536 nt, Acc. No. MW413437) and RNA2 (4,878 nt, MW413438) genome sequences shared 99.2% and 97.0% identity with CiLV-C2H-RNA1 (KC626783) and -RNA2 (KC626784). To further confirm the presence of CiLV-C2H in symptomatic P. edulis plants, 40 symptomatic leaf samples were individually tested by RT-PCR, and 30 samples were positive. Brevipalpus mites collected from CiLV-C2H-positive P. edulis leaves were transferred to common bean (Phaseolus vulgaris) seedlings (Garita et al. 2013). At 15-30 days post-transfer, RNA extracted from lesions observed in recipient plants tested positive for CiLV-C2H by RT-PCR. Total RNA from individual Brevipalpus mites was isolated, and cDNA was prepared to tentatively identify the mite species involved in CiLV-C2H transmission in passionfruit (Druciarek et al 2019, Olmedo-Velarde et al. 2021). CiLV-C2H was detected in individual mites, and the 28S ribosomal mite RNA sequence (MZ478051) shared 99-100% nucleotide identity with B. yothersi (MK293678 and MT812697), a vector of CiLV-C2 (Roy et al. 2013). CiLV-C2 currently has a host range limited to the families Malvaceae, Araceae, and Rutaceae (Roy et al. 2015). CiLV-C2H infects hibiscus alone and citrus in mixed infection with CiLV-C2 (Roy et al; 2018) which is responsible for causing citrus leprosis disease. Detection of CiLV-C2H in passionfruit expands the number of host families of CiLV-C2H.

In June 2020, Orchid fleck virus (OFV) was detected in a species of Liriope in Leon and Alachua County, Florida (Fife et al; 2021). In October of the same year, four adjacent dune/ear-leaf greenbrier vines, Smilax auriculata (Smilaceae: Liliales), showed yellowing and mottling symptoms (Figure 1). Infected and healthy S. auriculata leaves samples were collected in Alachua County by the Florida Department of Agriculture and Consumer Services, Gainesville, Florida. OFV primers successfully detected in four Smilax samples by conventional RT-PCR assay. Amplicon sequences (Acc. No. MZ645935 and MZ645938) shared 99% nucleotide identity with OFV infecting orchids (LC222629) and citrus (MK522804). The OFV subgroup I (OFV-Orc1) and subgroup II (OFV-Orc2) specific primers (Kondo et al 2017) were utilized to confirm the presence of OFV type strains infecting Smilax. Sanger sequencing of subgroup I specific amplicons (MZ645934) shared 99% nucleotide identity with OFV-Orc1 (LC222629) whereas subgroup II specific amplicon sequence (MZ645930) shared 98-99 % nucleotide identity with OFV-Orc2 (AB244417). Further confirmation was done by USDA-APHIS-PPQ-Plant Pathogen Confirmatory Diagnostics Laboratory utilizing optimized conventional RT-PCR protocols (Roy et al. 2020) and deep sequencing on a on a NextSeq550 Illumina platform. Assembled reads identified seven non-overlapping viral contigs. Five RNA1 and two RNA2 contigs covered more than 97% of the bipartite OFV genome with average coverage depth of 5297.61 and 5186.04, respectively. Contigs of RNA1 and RNA2 shared 98-99% nt identity to OFV-Orc2-RNA1 (AB244417) and OFV-Orc-RNA2 (AB244418 and LC222630). No other pathogen sequences were identified. This is the first time the genus Smilax has been identified as a natural host of OFV. Very recent findings of OFV-Orc in Florida in Liriope, Aspidistra, and Ophiopogon among the Asparagaceae family members (Fife et al; 2021) and now in the Smilacaceae suggest a broader host range of the virus than previously known; further research should be conducted to better characterize the potential risk of introduction into citrus in Florida.