Plant microbiomes are shaped by forces working at different spatial scales. Environmental factors determine a pool of potential symbionts while host physiochemical factors influence how those microbes associate with distinct plant tissues. These scales are seldom considered simultaneously, despite their potential to interact. Here, we analyze epiphytic microbes from nine Hibiscus tiliaceus trees across a steep, but short, environmental gradient within a single Hawaiian watershed. At each location, we sampled eight microhabitats: leaves, petioles, axils, stems, roots, and litter from the plant, as well as surrounding air and soil. The composition of bacterial communities is better explained by microhabitat, while location better predicted compositional variance for fungi. Fungal community compositional dissimilarity increased more rapidly along the gradient than did bacterial composition. Additionally, the rates of fungal community compositional dissimilarity along the gradient differed among plant parts, and these differences influenced the distribution patterns and range size of individual taxa. Within plants, microbes were compositionally nested such that aboveground communities contained a subset of the diversity found belowground. Our findings indicate that both environmental context and microhabitat contribute to microbial compositional variance in our study, but that these contributions are influenced by the domain of microbe and the specific microhabitat in question, suggesting a complicated and potentially interacting dynamic.

Ti ringspot is an emerging foliar disease of the ti plant (Cordyline fruticosa) in Hawaii that is quickly spreading throughout the islands. Symptoms include small chlorotic ringspots on leaves that often coalesce to form larger lesions. Although several virus species have been discovered in symptomatic plants, none have been associated with these symptoms. Here, we report and characterize a novel virus closely associated with ti ringspot symptoms in Hawaii. The presence of double membrane bodies approximately 85 nm in diameter in symptomatic cells and sequence analyses of five genomic RNA segments obtained by high-throughput sequencing indicate that this virus is most closely related to members of the plant virus genus Emaravirus. Phylogenetic and sequence homology analyses place this virus on a distinct clade within the Emaravirus genus along with High Plains wheat mosaic emaravirus, blue palo verde broom virus, and Raspberry leaf blotch emaravirus. Sequence identity values with taxonomically relevant proteins indicate that this represents a new virus species, which we are tentatively naming ti ringspot-associated virus (TiRSaV). TiRSaV-specific reverse transcription PCR assays detected the virus in several experimental herbaceous host species following mechanical inoculation. TiRSaV was also detected in eriophyid mites collected from symptomatic ti plants, which may represent a putative arthropod vector of the virus.

Coffee is one of the most economically valuable specialty crops for which Hawaii is famous. It is produced commercially on >6,900 acres across six islands by more than 1,470 growers. It has a raw c...

Hibiscus (Hibiscus spp.) are popular ornamental and landscape plants in Hawaii which are susceptible to foliar diseases caused by viruses belonging to the genera Cilevirus and Higrevirus (family Kitaviridae). In this study, a virus infecting H. rosa-sinensis plants displaying foliar symptoms consistent with infection by a kitavirus, including yellow chlorotic blotches with a green perimeter, was characterized. The genome consisted of two RNAs 8.4 and 4.4 kb in length, and was organized most similarly to cileviruses, but with important distinctions. These included the location of the p29 homolog as the 3′-terminal open reading frame (ORF) of RNA2 instead of its typical locus at the 3′-end of RNA1; the absence of a p15 homolog on RNA2 and the adjacent intergenic region which also harbors small putative ORFs of unknown function; and the presence of an ORF encoding a 10 kDa protein at the 3′-terminal end of RNA1 that was also found to be present in the hibiscus green spot virus 2 genome. Spherical particles approximately 55–65 nm in diameter were observed in infected leaf tissue, and viral RNA was detected by reverse-transcription PCR in individual mites collected from symptomatic plants tentatively identified as Brevipalpus yothersi. Although phylogenetic analyses placed this virus between the higrevirus and cilevirus clades, we propose the tentative taxonomic placement of this virus, designated hibiscus yellow blotch virus (HYBV), within the genus Cilevirus.

Citrus leprosis is an economically important disease of citrus in South and Central America. The disease can be caused by several non-systemic viruses belonging to the genera Cilevirus (family Kitaviridae) and Dichorhavirus (family Rhabdoviridae) (Roy et al. 2015; Freitas-Astúa et al. 2018). In February 2020, lesions consistent with citrus leprosis were observed on the leaves and stems of rough lemon (Citrus jambhiri) and mandarin (C. reticulata) trees in Hilo, Hawaii. Brevipalpus mites, vector of orchid fleck virus (OFV), were also present on these trees (Freitas-Astúa et al. 2018). To identify the virus associated with the symptoms, total RNA was isolated using a NucleoSpin RNA Plus kit (Macherey-Nagel) and underwent reverse transcription (RT)-PCR with two newly designed universal primers specific for dichorhaviruses (Dichora-R1-F1: 5`-CAYCACTGYGCBRTNGCWGATGA, Dichora-R1-R1: 5`-AGKATRTSWGCCATCCKGGCTATBAG). The expected ~350 bp amplicon was obtained and directly sequenced in both directions. Blastn and Blastx searches revealed that the primer-trimmed consensus sequence (MT232917) shared 99.3% nucleotide (nt) and 100% amino acid (aa) identity with an OFV isolate from Germany (AF321775). OFV has two orchid- (OFV-Orc1 and OFV-Orc2) and two citrus- (OFV-Cit1 and OFV-Cit2) infecting strains (Roy et al. 2020). However, an isolate of OFV-Orc1 has recently been associated with citrus leprosis in South Africa (Cook et al. 2019). To confirm the presence of OFV in Hawaiian citrus and identify the strain, symptomatic tissue was submitted to USDA-APHIS-PPQ-S&T where total RNA were extracted from the symptomatic tissue using RNeasy Plant Mini kit (Qiagen). The RNA samples were tested with OFV-Orc and OFV-Cit generic and specific primers in a conventional RT-PCR assay following optimized RT-PCR protocols (Roy et al. 2020). Two additional sets of generic primers (OFV-Orc-GPF: 5'-AGCGATAACGACCTTGATATGACACC, OFV-Orc-GPR: 5'-TGAGTGGTAGTCAATG CTCCATCAT and OFV-R2-GF1: 5'- CARTGTCAGGAGGATGCATGGAA, OFV-R2-GR: 5'- GACCTGCTTGATGTAATTGCTTCCTTC') were designed based on available OFV phospho (P) and large (L) polyprotein gene sequences in GenBank. These assays detected OFV-Orc2 in the symptomatic citrus samples, with the nucleocapsid (1353 bp), P (626 bp), and L (831 bp) gene sequences sharing 97 to 98% identity with published OFV-Orc2 sequences (AB244417 and AB516441). Ribo-depleted RNA (Ribo-Zero, Illumina) was prepared using a TruSeq Stranded Total RNA Library Prep kit (Illumina) and underwent high throughput sequencing (HTS) on a MiSeq platform (Illumina). The resulting 19.6 million 2x75bp reads were de novo assembled using SPAdes v. 3.10.0 (Bankevitch et al. 2012). In addition to sequences corresponding to citrus tristeza virus and citrus vein enation virus, two contigs of 6,412 nt (average depth 18,821; MW021482) and 5,986 nt (average depth 19,278; MW021483), were found to have ≥98% identity to RNA1 (AB244417) and RNA2 (AB244418) of OFV isolate So (Japan), respectively. This is the first report of OFV in Hawaii and the first time leprosis has been observed in the USA since it was eradicated from Florida in the 1960s, although that outbreak was attributed to infection by citrus leprosis virus-N0, a distant relative of OFV (Hartung et al. 2015). The recent detection of citrus leprosis associated with OFV infection in South Africa (Cook et al. 2019) and now Hawaii underscores the threat this pathogen poses to the global citrus industry.