ε-poly-l-Lysine (ε-PLL) peptide is a product of the marine bacterium Bacillus subtilis with antibacterial and anticancer activity largely used worldwide as a food preservative. ε-PLL and its synthetic analogue α,ε-poly-l-lysine (α,ε-PLL) are also employed in the biomedical field as enhancers of anticancer drugs and for drug and gene delivery applications. Recently, several studies reported the interaction between these non-canonical peptides and DNA targets. Among the most important DNA targets are the DNA secondary structures known as G-quadruplexes (G4s) which play relevant roles in many biological processes and disease-related mechanisms. The search for novel ligands capable of interfering with G4-driven biological processes elicits growing attention in the screening of new classes of G4 binders. In this context, we have here investigated the potential of α,ε-PLL as a G4 ligand. In particular, the effects of the incubation of two different models of G4 DNA, i.e., the parallel G4 formed by the Pu22 (d[TGAGGGTGGGTAGGGTGGGTAA]) sequence, a mutated and shorter analogue of the G4-forming sequence known as Pu27 located in the promoter of the c-myc oncogene, and the hybrid parallel/antiparallel G4 formed by the human Tel22 (d[AGGGTTAGGGTTAGGGTTAGGG]) telomeric sequence, with α,ε-PLL are discussed in the light of circular dichroism (CD), UV, fluorescence, size exclusion chromatography (SEC), and surface plasmon resonance (SPR) evidence. Even though the SPR results indicated that α,ε-PLL is capable of binding with µM affinity to both the G4 models, spectroscopic and SEC investigations disclosed significant differences in the structural properties of the resulting α,ε-PLL/G4 complexes which support the use of α,ε-PLL as a G4 ligand capable of discriminating among different G4 topologies.

Peptide nucleic acid (PNA) is a synthetic DNA mimic that outperforms the properties of traditional oligonucleotides (ONs). On account of its outstanding features, such as remarkable binding affinity towards complementary DNA or RNA as well as high thermal and chemical stability, PNA has been proposed as a valuable alternative to the ON probe in gene-sensor design. In this study, a hybrid transducer made-up of graphene oxide (GO) nano-sheets covalently grafted onto a porous silicon (PSi) matrix has been investigated for the early detection of a genetic cardiac disorder, the Brugada syndrome (BS). A functionalization strategy towards the realization of a potential PNA-based device is described. A PNA, able to detect the SCN5A gene associated with the BS, has been properly synthesized and used as a bioprobe for the realization of a proof-of-concept label-free optical PNA-biosensor. PSi reflectance and GO photoluminescence signals were simultaneously exploited for the monitoring of the device functionalization and response.

Cystic fibrosis (CF) is characterized by an airway obstruction caused by a thick mucus due to a malfunctioning Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) protein. The sticky mucus restricts drugs in reaching target cells limiting the efficiency of treatments. The development of new approaches to enhance drug delivery to the lungs represents CF treatment's main challenge. In this work, we report the production and characterization of hybrid core–shell nanoparticles (hNPs) comprising a PLGA core and a dipalmitoylphosphatidylcholine (DPPC) shell engineered for inhalation. We loaded hNPs with a 7-mer peptide nucleic acid (PNA) previously considered for its ability to modulate the post-transcriptional regulation of the CFTR gene. We also investigated the in vitro release kinetics of hNPs and their efficacy in PNA delivery across the human epithelial airway barrier using an ex vivo model based on human primary nasal epithelial cells (HNEC) from CF patients. Confocal analyses and hNPs transport assay demonstrated the ability of hNPs to overcome the mucus barrier and release their PNA cargo within the cytoplasm, where it can exert its biological function.

By combining the ability of short G-rich oligodeoxyribonucleotides (ODNs) containing the sequence ⁵′CGGA³′ to form higher order G-quadruplex (G4) complexes with the tetra-end-linked (TEL) concept to produce aptamers targeting the HIV envelope glycoprotein 120 (gp120), three new TEL-ODNs (1–3) having the sequence ⁵′CGGAGG³′ were synthesized with the aim of studying the effect of G4 dimerization on their anti-HIV activity. Furthermore, in order to investigate the effect of the groups at the 5′ position, the 5′ ends of 1–3 were left uncapped (1) or capped with either the lipophilic dimethoxytrityl (DMT) (2) or the hydrophilic glucosyl-4-phosphate (3) moieties. The here reported results demonstrate that only the DMT-substituted TEL-ODN 2 is effective in protecting human MT-4 cell cultures from HIV infection (76% max protection), notwithstanding all the three new aptamers proved to be capable of forming stable higher order dimeric G4s when annealed in K⁺-containing buffer, thus suggesting that the recognition of a hydrophobic pocket on the target glycoprotein by the aptamers represents a main structural feature for triggering their anti-HIV activity.

Zinc oxide nanowires (ZnONWs) are largely used in biosensing applications due to their large specific surface area, photoluminescence emission and electron mobility. In this work, the surfaces of ZnONWs are modified by covalent bioconjugation of a peptidic nucleic acid (PNA) probe whose sequence is properly chosen to recognize a complementary DNA (cDNA) strand corresponding to a tract of the CD5 mRNA, the main prognostic marker of chronic lymphatic leukemia. The interaction between PNA and cDNA is preliminarily investigated in solution by circular dichroism, CD melting, and polyacrylamide gel electrophoresis. After the immobilization of the PNA probe on the ZnONW surface, we demonstrate the ability of the PNA-functionalized ZnONW platform to detect cDNA in the μM range of concentration by electrical, label-free measurements. The specificity of the sensor is also verified against a non-complementary DNA sequence. These preliminary results highlight the potential application of PNA-bioconjugated ZnONWs to label-free biosensing of tumor markers.