With laminectomy being widely accepted as the treatment for lumbar disorders, epidural fibrosis (EF) is a common complication for both the patients and the surgeons alike. Currently, EF is thought to cause recurrent postoperative pain after laminectomy or after discectomy.Angelica sinensisis a traditional Chinese medicine which has shown anti-inflammatory, antifibrotic, and antiproliferative properties. The object of this study was to investigate the effects ofAngelica sinensison the prevention of post-laminectomy EF formation in a rat model. A controlled double-blinded study was conducted in sixty healthy adult Wistar rats that underwent laminectomy at the L1-L2 levels. They were divided randomly into 3 groups according to the treatment method, with 20 in each group: (1)Angelica sinensistreatment group, (2) saline treatment group, and (3) sham group (laminectomy without treatment). All rats were euthanized humanely 4 weeks after laminectomy. The hydroxyproline content, Rydell score, vimentin cells density, fibroblasts density, inflammatory cells density, and inflammatory factors expressions all suggested better results inAngelica sinensisgroup than the other two groups. Topical application ofAngelica sinensiscould inhibit fibroblasts proliferation and TGF-β1 and IL-6 expressions and prevent epidural scar adhesion in postlaminectomy rat model.

Introduction: This study aimed to identify biomarkers for acute and chronic brucellosis using advanced proteomic and bioinformatic methods.Methods: Blood samples from individuals with acute brucellosis, chronic brucellosis, and healthy controls were analyzed. Proteomic techniques and differential expression analysis were used to identify differentially expressed proteins. Co-expression modules associated with brucellosis traits were identified using weighted gene co-expression network analysis (WGCNA).Results: 763 differentially expressed proteins were identified, and two co-expression modules were found to be significantly associated with brucellosis traits. 25 proteins were differentially expressed in all three comparisons, and 20 hub proteins were identified. Nine proteins were found to be both differentially expressed and hub proteins, indicating their potential significance. A random forest model based on these nine proteins showed good classification performance.Discussion: The identified proteins are involved in processes such as inflammation, coagulation, extracellular matrix regulation, and immune response. They provide insights into potential therapeutic targets and diagnostic biomarkers for brucellosis. This study improves our understanding of brucellosis at the molecular level and paves the way for further research in targeted therapies and diagnostics.

In this study, we report for the first time the existence of complemented palindromic small RNAs (cpsRNAs) and propose that cpsRNAs and palindromic small RNAs (psRNAs) constitute a novel class of small RNAs. The first discovered 19-nt cpsRNA UUAACAAGCUUGUUAAAGA, named SARS-CoV-cpsR-19, was detected from a 22-bp DNA complemented palindrome TCTTTAACAAGCTTGTTAAAGA in the severe acute respiratory syndrome coronavirus (SARS-CoV) genome. The phylogenetic analysis supported that this DNA complemented palindrome originated from bat betacoronavirus. The results of RNA interference (RNAi) experiments showed that one 19-nt segment corresponding to SARS-CoV-cpsR-19 significantly induced cell apoptosis. Using this joint analysis of the molecular function and phylogeny, our results suggested that SARS-CoV-cpsR-19 could play a role in SARS-CoV infection or pathogenesis. The discovery of cpsRNAs has paved a way to find novel markers for pathogen detection and to reveal the mechanisms underlying infection or pathogenesis from a different point of view. Researchers can use cpsRNAs to study the infection or pathogenesis of pathogenic viruses when these viruses are not available. The discovery of psRNAs and cpsRNAs, as a novel class of small RNAs, also inspire researchers to investigate DNA palindromes and DNA complemented palindromes with lengths of psRNAs and cpsRNAs in viral genomes.

Colorectal cancer (CRC) is the second leading cause of cancer-related deaths. Those with advanced CRC continue to face a poor prognosis. Ferroptosis, a form of regulated cell death marked by iron accumulation, reactive oxygen species (ROS) elevation, and lipid peroxidation which represents a potential therapeutic strategy, particularly given the high iron and ROS levels often found in CRC cells. Andrographolide (AP), a diterpene lactone derived from Andrographis paniculata, has emerged as a potential anticancer agent. However, its ability to induce ferroptosis in CRC cells and the underlying mechanisms remain to be elucidated. This study aims to investigate whether AP can induce ferroptosis in colorectal cancer cells and to elucidate the underlying molecular mechanisms, both in vitro and in vivo. The effects and mechanisms of AP were examined in LoVo and HCT8 cells using various assays, including the CCK8 assay. The levels of mRNA in AP-treated cells were detected by transcriptome sequencing and verified by RT-qPCR as well as Westernblot. Network pharmacology and molecular docking techniques were employed to identify the drug's targets, alongside knockdown and overexpression experiments in cells to validate these targets. And in vivo patient-derived xenograft (PDX) model was constructed to assess the anti-tumor effects of AP in vivo and to validate the conclusions drawn from the in vitro experiments. AP effectively inhibited the proliferation and migration of LoVo and HCT8 cells and promoted their apoptosis. Transcriptome sequencing indicated that AP's inhibition of CRC was associated with ferroptosis. Subsequent experiments confirmed this prediction. The ferroptosis inhibitor Fer-1 attenuated the cytotoxic effects of AP on LoVo and HCT8 cells. AP treatment also resulted in AP treatment also resulted in mitochondrial dysfunction in both cell lines. Additionally, the expression levels of intracellular Solute Larrier Camily 7 Member 11 (SLC7A11) and Glutathione Peroxidase 4 (GPX4) were significantly reduced, while Glutathione/Oxidized glutathione (GSH/GSSG) levels decreased and the concentrations of Malondialdehyde (MDA) and free iron increased significantly. These effects were enhanced by Erastin and mitigated by Ferrostatin-1 (Fer-1). Network pharmacology and molecular docking predicted P53 as one of the core targets of AP for in CRC teratment. Knockdown and overexpression of P53 in LoVo and HCT8 cells lead to changes in downstream signaling pathways. Futhermore, in vivo studies using the PDX nude mouse model demonstrated that AP inhibited tumor growth, an effect that was reduced by Fer-1. The expression levels of SLC7A11 and GPX4, alongside the changes in GSH/GSSG, MDA, and free iron content, were consistent with the in vitro findings. Our data demonstrate that AP can induce ferroptosis in colorectal cancer by downregulating the SLC7A11/GPX4 signaling pathway, with P53 potentially serving as its target.