Gene therapy is manipulation in/of gene expression in specific cells/tissue to treat diseases. This manipulation is carried out by introducing exogenous nucleic acids, such as DNA or RNA, into the cell. Because of their negative charge and considerable larger size, the delivery of these molecules, in general, should be mediated by gene vectors. Non-viral vectors, as promising delivery systems, have received considerable attention due to their low cytotoxicity and non-immunogenicity. As research continued, more and more functional non-viral vectors have emerged. They not only have the ability to deliver a gene into the cells but also have other functions, such as the performance of fluorescence imaging, which aids in monitoring their progress, targeted delivery, and biodegradation. Recently, many reviews related to non-viral vectors, such as polymers and cationic lipids, have been reported. However, there are few reviews regarding functional non-viral vectors. This review summarizes the common functional non-viral vectors developed in the last ten years and their potential applications in the future. The transfection efficiency and the transport mechanism of these materials were also discussed in detail. We hope that this review can help researchers design more new high-efficiency and low-toxicity multifunctional non-viral vectors, and further accelerate the progress of gene therapy.

Skeletal systems provide support, movement, and protection to the human body. It can be affected by several life suffering bone disorders such as osteoporosis, osteoarthritis, and bone cancers. It is not an easy job to treat bone disorders because of avascular cartilage regions. Treatment with non-specific drug delivery must utilize high doses of systemic administration, which may result in toxicities in non-skeletal tissues and low therapeutic efficacy. Therefore, in order to overcome such limitations, developments in targeted delivery systems are urgently needed. Although the idea of a general targeted delivery system using bone targeting moieties like bisphosphonates, tetracycline, and calcium phosphates emerged a few decades ago, identification of carrier systems like viral and non-viral vectors is a recent approach. Viral vectors have high transfection efficiency but are limited by inducing immunogenicity and oncogenicity. Although non-viral vectors possess low transfection efficiency they are comparatively safe. A number of non-viral vectors including cationic lipids, cationic polymers, and cationic peptides have been developed and used for targeted delivery of DNA, RNA, and drugs to bone tissues or cells with successful consequences. Here we mainly discuss such various non-viral delivery systems with respect to their mechanisms and applications in the specific targeting of bone tissues or cells. Moreover, we discuss possible therapeutic agents that can be delivered against various bone related disorders.

Mammalian hibernation is composed of multiple episodes of torpor bout, separated by phases of interbout arousal. During torpor, the skeletal muscles of mammals are undoubtedly inactive, but it has been proven to mitigate disuse atrophy. While interbout arousal has been implicated in the prevention of muscle atrophy, the underlying mechanisms sustaining muscle contraction remain to be explored. In the present study, Daurian ground squirrels (Spermophilus dauricus) were divided into four groups: pre-hibernation (PRE), torpor (TOR), interbout arousal (IBA), and post-hibernation (POST). The contractile performance of slow-twitch soleus muscle (SOL) and fast-twitch extensor digitorum longus muscle (EDL) was detected both in situ and in vitro. Concurrently, mitochondrial respiratory chain complex activity in these muscles was quantified. Our findings revealed that in situ contractile properties of both muscles, including force, power output, time duration, and force development/relaxation rates of twitch contraction, and force and power output of tetanic contraction declined in the TOR group compared to the PRE group, but improved in the IBA and POST groups. Fatigue resistance of muscles, determined by the power output of repetitive tetanic contractions in situ, decreased in the TOR group but recovered in the IBA and POST groups. In vitro studies demonstrated that tetanic contraction power output in isolated muscles increased with muscle temperature in both TOR and IBA groups. However, at the same temperature, power output was consistently lower in the TOR group compared to the IBA group. Moreover, the activity of the mitochondrial respiratory chain complex, especially Complexes I and II, decreased in the TOR group but showed recovery in the IBA and POST groups. These findings suggest that both the contractile performance and fatigue resistance of mammalian skeletal muscle are compromised during torpor but can be improved during interbout arousal and post-hibernation. The rebound in body temperature and rise in mitochondrial respiratory chain complex activity in skeletal muscle are involved in enhancing contractile performance and fatigue resistance. This study suggests that interbout arousal functions as a vital temporal interval during which skeletal muscles can transition from the inactivity induced by torpor to a state of restored contractile functionality. Thus, interbout arousal serves as a behavioral safeguard against disuse-induced damage to skeletal muscles during hibernation.

RNA-binding proteins (RBPs), which regulate gene expression through post-transcriptional modifications of RNAs, play a role in diverse biological processes that include bone cell development and bone tissue formation. RBP dysregulation may result in aberrant bone homeostasis and contribute to various bone diseases. The function of RBPs in bone physiology and pathophysiology and the underlying molecular mechanisms have been extensively studied in recent years. This article provides a review of such studies, highlighting the potential of RBPs as pivotal targets for therapeutic intervention.

Prolonged skeletal muscle disuse, such as extended inactivity and mechanical unloading, typically elicits severe muscle atrophy and progressive bone loss, yet hibernating mammals evade this pathological cascade via poorly defined adaptive mechanisms. Using the Daurian ground squirrel (Spermophilus dauricus) as a unique natural model of prolonged torpor, we demonstrate that skeletal muscle-derived small extracellular vesicles (Mu-EVs) orchestrate protective muscle–bone crosstalk to maintain bone homeostasis during extended disuse. Morphological and microstructural analyses revealed no significant deficits in skeletal muscle and tibial bone between pre-hibernation (PRE) and torpor (TOR) states. Compared with PRE-Mu-EVs, TOR-Mu-EVs significantly enhanced osteogenic differentiation in MC3T3-E1 osteoblasts, markedly upregulating mRNA expression of the key osteogenic markers OCN and COL1A1 (p < 0.05, p < 0.01). Small RNA sequencing identified a novel unannotated miRNA (mature sequence: GCAGCAGCCCGGCTCTCCTAAT) sharply downregulated in TOR-Mu-EVs (p < 0.01); this miRNA exhibits binding potential toward the transcript of Bmp7, a pivotal regulator of osteogenesis. In vitro functional assays confirmed that this miRNA suppresses osteoblast maturation; in a mouse hindlimb unloading (HLU) disuse osteoporosis model, miRNA antagomir partially alleviated bone loss, boosting Masson staining area by 27.13% (p < 0.05) and bone volume fraction by 15.01% (n = 5, 0.05 < p < 0.1, Cohen’s d = 0.71, 95% CI [−0.16, 1.38]). Collectively, hibernating Mu-EVs mitigate this BMP7-inhibiting miRNA to sustain osteogenic activity, hinting at a conserved regulatory cascade that could offer tentative translational clues for managing disuse osteoporosis.