Banker plant systems can be used to sustain a reproducing population of biological control agents (BCAs) within a crop, thus providing long-term pest suppression. The founder population of natural enemies in banker plant systems is usually mass-reared on factitious hosts. Thus, a better understanding of the population fitness and pest control performance of mass-reared BCAs in the field is crucial when developing integrated pest management (IPM) strategies. In this study, we determined the fitness of the generalist predator, Chrysopa pallens (Hemiptera: Chrysopidae) ever cultured on different food sources (i.e., mass rearing food, Corcyra cephalonica eggs, and aphid food, Megoura japonica) preying on Aphis craccivora in a banker plant system in a greenhouse based on Chi’s age-stage, two-sex life table analysis method. The life tables and predation rate parameters of C. pallens were not significantly different between both treatments under fluctuating temperature conditions. Corcyracephalonica eggs did not significantly weaken the performances of C. pallens in a Vicia faba–A. craccivora banker plant system compared to aphids. In conclusion, C. cephalonica eggs can be used for the mass production of C. pallens as the founder population in a banker plant system. Moreover, linking the life table data with the predation rate is an effective strategy for evaluating mass rearing programs in establishing banker plant systems.

Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.

Tomato chlorosis virus (ToCV), transmitted by the whitefly, Bemisia tabaci (Gennadius; Hemiptera: Aleyrodidae) has been continuously emerging on tomato plants and causing a significant economic loss throughout China. In the current study, RNA-Seq analysis was used to explore the gene expression profiles of B. tabaci Mediterranean (MED) that fed on both ToCV-infected and -uninfected tomato plants for 6, 12, 24, and 48 hours, respectively. The results revealed that dynamic changes occurred in the gene expressions of whiteflies at different time intervals after they acquired the virus. A total of 1709, 461, 4548, and 1748 differentially expressed genes (DEGs) were identified after a 6, 12, 24, and 48 hours feeding interval for the viral acquisition, respectively. The least number of expressed genes appeared in whiteflies with the 12 hours feeding treatment, and the largest numbers of those found in those with 24 hours feeding treatment. Kyoto Encyclopedia of Genes and Genomes pathway analysis revealed that B. tabaci MED responded to ToCV acquisition through altering its nerve system development, fertility, detoxification, glucose metabolism, and immune function before it lost its ability to transmit the virus. The number of DEGs, degree of differential gene expressions, expression level of the same gene, involved biological processes, and metabolic functions in whiteflies post the 12 hours feeding, and viral acquisition were different from those from other three feeding treatments, which could be a significant finding suggesting an effective control of B. tabaci MED should be done less than 12 hours after whiteflies started feeding on ToCV-infected tomatoes. Our results further provided a clarified understanding in how B. tabaci was protected from viral acquisitions through comparison of the differential profile of gene expressions in whiteflies feeding on plants that were infected by semipersistent viruses.

Tomato (Solanum lycopersicum) gray leaf spot disease is a predominant foliar disease of tomato in China that is caused mainly by the necrotrophic fungal pathogen Stemphylium lycopersici. Little is known regarding the pathogenic mechanisms of this broad-host-range pathogen. In this study, a comparative transcriptomic analysis was performed and more genetic information on the pathogenicity determinants of S. lycopersici during the infection process in tomato were obtained. Through an RNA sequencing (RNA-seq) analysis, 1,642 and 1,875 genes upregulated during the early infection and necrotrophic phases, respectively, were identified and significantly enriched in 44 and 24 pathways, respectively. The induction of genes associated with pectin degradation, adhesion, and colonization was notable during the early infection phase, whereas during the necrotrophic phase, some structural molecule activity-related genes were prominently induced. Additionally, some genes involved in signal regulation or encoding hemicellulose- and cellulose-degrading enzymes and extracellular proteases were commonly upregulated during pathogenesis. Overall, we present some putative key genes and processes that may be crucial for S. lycopersici pathogenesis. The abilities to adhere and colonize a host surface, effectively damage host cell walls, regulate signal transduction to manage infection, and survive in a hostile plant environment are proposed as important factors for the pathogenesis of S. lycopersici in tomato. The functional characterization of these genes provides an invaluable resource for analyses of this important pathosystem between S. lycopersici and tomato, and it may facilitate the generation of control strategies against this devastating disease.