Muskmelon (Cucumis melo L.) is a widely cultivated and economically important fruit crop worldwide. In June 2022, fruit rot symptoms were observed on ripening muskmelons (cv. Boyang) in Shouguang C...

RNA viruses tend to mutate during transmission and host infection, which is critical to viral adaptation and evolution. Tomato mosaic virus (ToMV) is a member of the genus Tobamovirus (family Virgaviridae) and an economically important virus with detrimental effects on tomatoes worldwide. Although the ToMV gene sequences have been completed in China, their genetic diversity and population structure remain unclear. We collected 425 tomato samples from tomato-growing areas in three northern Chinese provinces 2016. Reverse transcription PCR results showed that the average incidence of the virus in the field samples was 67.15%, and ToMV was detected in all test areas. The analysis of ToMV single nucleotide polymorphisms in China showed that ToMV was evolutionarily conserved, and the variation in the whole genome was uneven. Pairwise identity analysis showed significant variability in genome sequences among ToMV strains with genomic nucleotide identities of 73.2–99.6%. The ToMV population in the northern Chinese provinces had purification and selection functions, which were beneficial in the evolution of the ToMV population. Although there has been some distribution of ToMV strains in China, the virus was generally stabilized as a uniform strain under the pressure of purification selection. Our findings show how to monitor the prevalent strains of ToMV and their virulence in China and provide useful information for its prevention and control.

Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.

Muskmelon (Cucumis melo L.) is one of the most widely cultivated and economically important fruit crops in the world. However, many pathogens can cause decay of muskmelon fruit, including Fusarium ...

Ilex cornuta (Aquifoliaceae) is an evergreen shrub native to China and widely cultivated for ornamental and medicinal purposes. In March 2024, anthracnose symptoms were observed on I. cornuta leaves in an urban park in Shouguang City, Shandong Province, China (36°53'42.16″N, 118°47'22.4″E), showing a 10-30% incidence rate among surveyed plants (approximately 0.5 ha). Initial symptoms manifested as small brown leaf spots, subsequently expanding into large irregular gray necrotic areas with dark-brown margins. Ten symptomatic leaves were randomly collected from six trees. Fifteen tissue sections (4 × 4 mm) from lesion margins were surface-sterilized in 75% ethanol for 30 s, followed by 1% NaClO for 30 s, rinsed thrice with sterile water. The tissues were transferred to potato dextrose agar (PDA) plates and cultured at 25°C for 3 days. Ten morphologically identical fungal strains were isolated via single-spore purification. Two representative isolates (GG-1, GG-2) were characterized morphologically and molecularly. Colonies on PDA attained 8.2 cm diameter after 5 days at 25°C, displaying white to gray-white aerial mycelium with white margins. Conidia were cylindrical, aseptate, with obtuse to subrounded ends, 14-18 × 4-6 μm (average: 16.2 × 5.3 μm, n = 50). Appressoria appeared spherical to elliptical, 5-6 × 4-6 μm (average: 5.8 × 5.0 μm, n = 50). Morphological characteristics aligned with Colletotrichum gloeosporioides species complex (Weir et al. 2012). For molecular confirmation, five loci-ITS (GenBank accession nos. PV449822, PV449823), ACT (PV472613, PV472614), CAL (PV454441, PV454442), CHS (PV472621, PV472622) and TUB2 (PV472617, PV472618) were amplified using universal primers (Yang et al. 2024) and sequenced. BLASTn analysis revealed 99-100% identity with corresponding sequences of the ex-type strain C. gloeosporioides IMI 356878 (ITS: JX010152; ACT: JX009531; TUB2: JX010445; CAL: JX009731; CHS: JX009818). A multilocus maximum likelihood phylogeny reconstructed with MEGA 11.0 placed isolates GG-1 and GG-2 within the C. gloeosporioides clade, supported by 99% bootstrap values. To fulfill Koch's postulates, pathogenicity test was assessed using healthy 2-year-old seedlings in greenhouse. Five seedlings were sprayed with either conidial suspension (1 × 10⁶ conidia/ml) or pure water on leaves. All plants were potted at 25 °C with 75% relative humidity and a 12-h photoperiod. Experiments were repeated three times. After 10 days, inoculated seedlings showed necrotic leaf spots consistent with field observations, while controls remained asymptomatic. C. gloeosporioides was reisolated (100% recovery rate) from lesions and confirmed through morphological assessment and multilocus sequencing. This pathogen has previously documented to cause anthracnose on leaves of various hosts, such as Sorbaria sorbifolia (Li et al. 2019), Akebia trifoliata (Pan et al. 2020), and Wisteria sinensis (Chen et al. 2023). To our knowledge, this is the first report of C. gloeosporioides causing anthracnose on I. cornuta in China, providing critical information for developing targeted management strategies against this emerging disease.

Euonymus japonicus, an evergreen shrub, is widely planted in parks and along roadsides in temperate and subtropical regions due to its high adaptability. In January 2025, E. japonicus leaf spot was observed at Weifang University of Science and Technology, Shandong Province, China (118.78°E, 36.89°N), with 20-40% of leaves per plant affected (n = 230 plants). Irregular chlorotic spots appeared on the surface of the leaves, then larger necrotic spots showed grayish-white centers and brown margins formed. Numerous pycnidia appeared at later stages of development. To isolate the pathogen, 20 symptomatic leaves were collected from ten trees and cut into small pieces (0.4 cm²) at the junction between diseased and healthy tissue. All pieces were surface disinfected with 75% ethanol for 30 s then rinsed three times with sterilized distilled water, dried with sterilized filter paper, placed on potato dextrose (PDA), and incubated in darkness at 27 ° C. Seventeen isolates were obtained using the hyphal-tip method, all of which exhibited similar morphological characteristics. Colonies initially appeared white, and after 5-7 days, they gradually turned gray-green to dark gray with dense aerial mycelia. Conidia forming on pycnidia were one-celled, hyaline, fusiform, subtruncate at the base, subobtuse at the apex, and measured 19.4 -25.9 μm (23.1 ± 1.6 μm) × 5.2 - 9.2 μm (7.1 ± 0.9 μm) (n = 30), consistent with the description of Botryosphaeria dothidea (Zhang et al. 2021). Genomic DNA was extracted from the mycelia of 6-day-old cultures of two representative isolates, DQWM01 and DQWM02. PCR amplifications were performed using primer pairs ITS1/ITS4, EF1-728F/EF1-986R, and Bt2a/Bt2b (White et al. 1990; Carbone and Kohn 1999; Jia et al. 2019) to target the internal transcribed spacer (ITS) region, translation elongation factor 1-alpha (TEF1-α) gene, and β-tubulin (TUB2) gene, respectively. Sequences (GenBank accession nos. PV413678 and PV413679 for ITS, PV441490 and PV441491 for TEF1-α, PV441488 and PV441489 for TUB2) showed 99.5 to 100% homology with ITS (AY236949), TUB2 (AY236927) and TEF1-α (AY236898) sequences from ex-type B. dothidea isolate CBS 115476. Results from the maximum likelihood analyses, based on the three concatenated gene sequences using PhyloSuite version 1.2.2 (Zhang et al., 2020), placed the isolates in a clade with B. dothidea. To assess pathogenicity, ten healthy leaves from each of five 1-year-old E. japonicus plants grown in a greenhouse were wounded with a sterilized needle. Mycelial plugs (6 mm diameter) from actively growing colonies of isolate DQWM01 on PDA were applied to 5 leaves of E. japonicus, while the other 5 wounded leaves on the same plant were treated with agar plugs. All plants were incubated at 25°C, 70% humidity, and 14 h/10 h photoperiod. Seven days after inoculation, brown lesions appeared, which turned grayish-white with brown margins, similar to field symptoms, but the control leaves remained symptomless. B. dothidea culture was reisolated from all the infected leaves and identified using morphological characteristics and DNA sequence analysis, completing Koch's postulates. The pathogenicity test was performed three times with similar results. To our knowledge, this is the first report of B. dothidea in China causing leaf spot on E. japonicus. The disease significantly threatens E. japonicus's ornamental value, requiring urgent and targeted control measures.