RNA viruses tend to mutate during transmission and host infection, which is critical to viral adaptation and evolution. Tomato mosaic virus (ToMV) is a member of the genus Tobamovirus (family Virgaviridae) and an economically important virus with detrimental effects on tomatoes worldwide. Although the ToMV gene sequences have been completed in China, their genetic diversity and population structure remain unclear. We collected 425 tomato samples from tomato-growing areas in three northern Chinese provinces 2016. Reverse transcription PCR results showed that the average incidence of the virus in the field samples was 67.15%, and ToMV was detected in all test areas. The analysis of ToMV single nucleotide polymorphisms in China showed that ToMV was evolutionarily conserved, and the variation in the whole genome was uneven. Pairwise identity analysis showed significant variability in genome sequences among ToMV strains with genomic nucleotide identities of 73.2–99.6%. The ToMV population in the northern Chinese provinces had purification and selection functions, which were beneficial in the evolution of the ToMV population. Although there has been some distribution of ToMV strains in China, the virus was generally stabilized as a uniform strain under the pressure of purification selection. Our findings show how to monitor the prevalent strains of ToMV and their virulence in China and provide useful information for its prevention and control.

Quantitative real-time PCR (qRT-PCR) in sweet potatoes requires accurate data normalization; however, there are insufficient studies on appropriate reference genes for gene expression analysis. We examined variations in the expression of eight candidate reference genes in the leaf and root tissues of sweet potatoes (eight nonvirus-infected or eight virus-infected samples). Parallel analyses with geNorm, NormFinder, and Best-Keeper show that different viral infections and origin tissues affect the expression levels of these genes. Based on the results of the evaluation of the three software, the adenosine diphosphate-ribosylation factor is suitable for nonvirus or virus-infected sweet potato leaves. Cyclophilin and ubiquitin extension proteins are suitable for nonvirus-infected sweet potato leaves. Phospholipase D1 alpha is suitable for virus-infected sweet potato leaves. Actin is suitable for roots of nonvirus-infected sweet potatoes. Glyceraldehyde-3-phosphate dehydrogenase is suitable for virus-infected sweet potato roots. The research provides appropriate reference genes for further analysis in leaf and root samples of viruses in sweet potatoes.

Sponge gourd (Luffa cylindrica) and watermelon (Citrullus lanatus) are important cash crops in China. In September 2015, interveinal yellow spots and chlorosis, suspected to be caused by the tomato chlorosis virus (ToCV; genus Crinivirus), were observed on sponge gourd and watermelon plants in six greenhouses in the cities of Shouguang, Dezhou, and Taian (2 greenhouses in each city) of Shandong Province. The incidences of the disease in sponge gourd and watermelon greenhouses were 10% to 20%. To identify causative pathogens, 20 sponge gourd and 15 watermelon samples were collected from cucurbit plant facilities in Shandong Province, China. Total RNA was extracted from the samples using RNA simple Total RNA kit (Tiangen Biotech Co., Ltd., Beijing, China) according to the manufacturer's protocol. Reverse transcription-polymerase chain reaction (RT-PCR) of ToCV was performed using To-CP-forward (ATGGAGAACAGTGCTGTTGC)/To-CP-reverse (TTAGCAACCAGTTATCGATGC) primer pair (Hirota et al. 2010). DNA fragments of approximately 780 bp were detected in all sponge gourd and watermelon samples. The fragments were inserted into pMD18-T vector (Takara, Shiga, Japan), which was subsequently transformed into Escherichia coli DH5α. Sponge gourd (n=1; ToCV-sponge gourd) and watermelon (n=1; ToCV-watermelon)-positive samples were selected for Sanger sequencing. BLASTN comparison of the sequencing results confirmed the presence of ToCV. The sequencing results were processed using DNAMAN version 6.0 (Lynnon Biosoft, USA) and submitted to the GenBank database (https://www.ncbi.nlm.nih.gov/). The phylogenetic tree based on ToCV coat protein (CP) was constructed using amplified ToCV-sponge gourd, ToCV-watermelon, and ToCV representative sequences in GenBank database. According to the results, the ToCV sponge gourd and watermelon sequences belonged to an independent branch with the Chinese ToCV isolate (KC812619). Sequence analysis based on nucleotide sequences of ToCV CP demonstrated that ToCV-sponge gourd and ToCV-watermelon isolates shared the highest nucleotide sequence identity of 99.7% with the Chinese isolate (KC812619). To assess the transmissibility of ToCV, virus-free whiteflies (Bemisia tabaci) (n = 30) were placed for one day on ToCV-infected sponge gourd and watermelon plants for virus acquisition. Thereafter, whiteflies were transferred onto the virus-free sponge gourd (cv. 'Changlv', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) and watermelon (cv. 'ZaoJia 8424', 4-leaf-stage, n = 6 for each of the control, ToCV treatment) seedlings for one day. Three weeks later, all plants from tested group showed same symptoms as those observed in the greenhouses, whereas plants in the control group were symptom-free. RT-PCR analysis confirmed the ToCV infection in sponge gourd and watermelon plants, whereas control plants were found uninfected. ToCV infection in sponge gourds and watermelons has not been reported previously. To the best of our knowledge, this is the first report of sponge gourd and watermelon being natural hosts of ToCV worldwide. We believe that spread of ToCV in cucurbits needs attention.

Tomato chlorosis virus (ToCV) severely threatens tomato production worldwide. P27 is known to be involved in virion assembly, but its other roles in ToCV infection are unclear. In this study, we found that removal of p27 reduced systemic infection, while ectopic expression of p27 promoted systemic infection of potato virus X in Nicotiana benthamiana. We determined that Solanum lycopersicum catalases (SlCAT) can interact with p27 in vitro and in vivo and that amino acids 73 to 77 of the N-terminus of SlCAT represent the critical region for their interaction. p27 is distributed in the cytoplasm and nucleus, and its coexpression with SlCAT1 or SlCAT2 changes its distribution in the nucleus. Furthermore, we found that silencing of SlCAT1 and SlCAT2 can promote ToCV infection. In conclusion, p27 can promote viral infection by binding directly to inhibit anti-ToCV processes mediated by SlCAT1 or SlCAT2.

Root rot caused by Fusarium spp. is a destructive disease affecting agricultural regions worldwide. Strawberries (Fragaria × ananassa Duch.) are an economically important crop in China. In March 2023, root rot was observed in strawberries grown in Jinan, Shandong Province, China. Symptoms included leaf wilt, necrotic roots, and plant death (Figure 1). Four strawberry samples (two symptomatic and two asymptomatic) were collected from ~2-acre fields where the disease incidence rate ranged from 2 to 3%. Tissue pieces (5 mm × 5 mm × 5 mm) from two healthy and two diseased strawberry root tissues were surface-disinfected with 75% ethanol for 3 min, treated with 10% sodium hypochlorite for 5 min, and washed three times with sterile water. These pieces were cultured for 5 days at 28°C on potato dextrose agar (PDA) containing 200 mg/L timentin. Typical Fusarium spp. like growth was observed on plates with the two symptomatic samples. Two representative fungal isolates (CM1 and CM2) with similar morphological characteristics were purified using the single-spore method (Figure 1). CM1 showed an average growth rate of 5 mm/d in PDA and comprised of several white-to-cream aerial mycelia after 5 d. After cultivation in carnation leaf agar medium for 7 d, falciform macroconidia, with blunt apical cells and slightly hooked basal cells comprising 3 to 4 septa of varying sizes (20 to 39)×(3.6 to 6.7 μm) were observed (n=50) (Figure 1). The chlamydospores were spherical, terminal or intercalary, solitary or chain-forming, and 3.1-10.5 μm in diameter (Figure 1). The microconidia on PDA were (5.8 to 13.6)× (2.5 to 3.3) μm in size (n=50). These morphological characteristics are consistent with previous descriptions of the Fusarium solani species complex (FSSC). DNA was extracted using the CTAB method (Stenglein and Balatti 2006). The internal transcribed spacer (ITS), translation elongation factor 1-α gene (tef1), RNA polymerase II largest subunit (rpb1), and RNA polymerase II second largest subunit (rpb2) were amplified and sequenced using specific primers (O'Donnell et al. 2010). The ITS (OR526528, OR526529), tef1 (OR536947, OR536948), rpb1 (OR536949, OR536950), and rpb2 (OR536951, OR536952) sequences of the CM1 and CM2 isolates were uploaded to the NCBI database. BLASTn analysis revealed that the ITS, tef1, rpb1, and rpb2 sequences were 99.1-100% identical to those of the Fusarium falciforme reference strains NRRL 54989 and NRRL 54978. A phylogenetic tree based on the ITS, tef1, rpb1, and rpb2 sequences was generated using MEGA v.11 via the maximum-likelihood method (Tamura et al. 2021). CM1 clustered with the Fusarium falciforme reference strains NRRL 54989 and NRRL 54978 and belonged to the FSSC based on its morphological and molecular characteristics (Figure 2). To test for pathogenicity, the roots of nine 3-month-old healthy strawberry (cv. Akihime) plants were exposed to conidial suspensions (1×10⁸ spores/mL) of the CM1 isolate. Another nine root samples were treated with sterile water and used as controls. All strawberry plants were maintained in a growth chamber under a 12/12 h light/dark cycle at 28°C and 90% relative humidity and the experiment was repeated three times. After one month, the inoculated plants had withered and died, and the pith became dark red (similar to field plants) (Figure 1). The fungi isolated from the experimental plants were confirmed as F. falciforme using morphological and sequence analyses. F. falciforme causes root rot in several species including Nicotiana tabacum (Qiu et al. 2023) and Weigela florida (Shen et al. 2020); however, this study is the first to report root rot caused by F. falciforme in strawberries in China. Overall, F. falciforme infection poses a threat to strawberry production and breeding.

Tomato (Solanum lycopersicum L.) is a fruit of great economic value that is grown worldwide. In November 2022, fruit rot symptoms were observed in cherry tomatoes (cv. Qianxi) in Jinan City of Shan...