Essential oils are substances originated from plants in general. These compounds are well known to have a high biological activity, specially the antioxidant and antimicrobial. Several extraction techniques are employed to obtain these substances. However, the majority of these techniques require a long extraction time. In this sense, innovative and alternative extraction techniques, such as ultrasound, have recently been the target of studies. In view of the small amount of publications using ultrasonic pretreatment, this review aimed to congregate current relevant information on ultrasound-assisted extraction of essential oils. In this sense, theoretical aspects, such as the main factors that influence the performance of this technique as well as the advantages and disadvantages of the use of ultrasound as an environmental friendly alternative technique to improve the extraction of essential oil in comparison to traditional methods, are shown. Considering the available studies in the literature on essential oil extraction using ultrasonic pretreatment, low frequencies ranged from 20 to 50kWz and times ranged from 20 to 40min were used. The use of ultrasonic pretreatment represents a time reduction to near 70% in relation to the conventional hydrodistillation. Also, these conditions enabled a growth in the extraction of bioactive compounds and consequently improving the antioxidant and antimicrobial activities of essential oils.

Honey has numerous uses and composes formulations of many food, pharmaceutical, and cosmetic products due to its chemical, biological, and sensorial characteristics. In recent years, several reports and scientific articles claim the contamination of honey by antibiotics, a fact that is a public health problem since the ingestion of them can cause several side effects. In this sense, the purpose of this work was to carry out a literature review in international circulation databases about the contamination of honey by antibiotics in the last 10 years. It is observed in the literature that several quality control methods for evaluating this product have been developed, with the main objective of detecting trace concentrations of these compounds. In this context, the chromatographic techniques, rapid tests, immunoassays, and the use of emerging technologies that are considered sustainable for sample preparation stand out. When these methods are applied to honey samples, it is clear that the contamination of honeys by antibiotic residues has been growing every year, making it evident that programs for continuous monitoring of these residues in honeys are conducted. Also, not only has the amount of antibiotics increased, but also the diversity of assets being used. Regarding the residues present, the main antibiotics found in the evaluated samples belong to the class of tetracyclines, sulfonamides, aminoglycosides, macrolides, and amphenicols. However, few countries report maximum residue limits (MRL) allowed for these substances in honey, and in Brazil, as well as in the European Union, no MRL has been established for antibiotics in this product so far, which indicates that it is extremely important that MRL be adopted to ensure food safety for consumers.

Flaxseed (Linum usitatissimum L.) displays functional properties and contains α-linolenic acid (omega-3). It also contains soluble and insoluble fiber, lignans, phenolic acids, flavonoids, phytic acid, vitamins, and minerals. However, its microbiota can cause fungal contaminations, drastically reducing its quality. The objective of this work was to identify the fungi present in bulk flaxseed through the internal transcribed spacer (ITS1) intergenic region using a metataxonomics approach. Fungal identification was performed via high-performance sequencing of the ITS1 region using ITS1 (GAACCWGCGGARGGATCA) and ITS2 (GCTGCGTTCTTCATCGATGC) as primers with 300 cycles and single-end sequencing in the MiSeq Sequencing System equipment (Illumina Inc., San Diego, CA, USA). Six genera and eight species of fungi were found in the sample. The genus Aspergillus stood out with three xerophilic species found, A. cibarius, A. Appendiculatus, and A. amstelodami, the first being the most abundant. The second most abundant genus was Wallemia, with the species W. muriae. This is one of the fungi taxa with great xerophilic potential, and some strains can produce toxins. Metataxonomics has proved to be a complete, fast, and efficient method to identify different fungi. Furthermore, high-performance genetic sequencing is an important ally in research, helping to develop novel technological advances related to food safety.