This page has only limited features, please log in for full access.
The genus Helichrysum Mill comprises hundreds of species that are mostly flowering perennial shrubs. Some of these plants that belong to the Helichrysum species are used in traditional medicine to treat cough, back pain, diabetes, asthma, digestive problems, menstrual pain, chest pain, kidney disorders, skin disorders, wounds, open sores, among other conditions, but, only a few scientific studies are reported in the literature with sufficient information that validates the acclaimed folkloric benefits of these plants. This review, therefore, provides a comprehensive update of the available information on the cytotoxicity, genotoxicity, anti-proliferative, anti-bacterial, anti-fungal, anti-viral, anti-HIV, anti-malarial, anti-ulcerogenic, anti-tyrosinase, anti-inflammatory, and anti-oxidant activities of selected Helichrysum species of interest: H. petiolare, H. cymocum, H. foetidum, and H. pandurifolium Schrank, using scientific databases as well as electronic and print sources. The ethnobotanical and morphological characteristics as well as the phytochemical composition and biological activities of these plants are elucidated. The scientific rationale for their current use is discussed based on the evidence in the literature. This review highlights the putative use of the Helichrysum species as a reliable source of bioactive compounds for the production of standard commercial drugs to treat many ailments, including those reported in folkloric uses. Further research on the many plants in the genus Helichrysum is recommended to explore their economic importance both as edible crops and medicinal botanicals.
Kolajo Akinyede; Christopher Cupido; Gail Hughes; Oluwafemi Oguntibeju; Okobi Ekpo. Medicinal Properties and In Vitro Biological Activities of Selected Helichrysum Species from South Africa: A Review. Plants 2021, 10, 1566 .
AMA StyleKolajo Akinyede, Christopher Cupido, Gail Hughes, Oluwafemi Oguntibeju, Okobi Ekpo. Medicinal Properties and In Vitro Biological Activities of Selected Helichrysum Species from South Africa: A Review. Plants. 2021; 10 (8):1566.
Chicago/Turabian StyleKolajo Akinyede; Christopher Cupido; Gail Hughes; Oluwafemi Oguntibeju; Okobi Ekpo. 2021. "Medicinal Properties and In Vitro Biological Activities of Selected Helichrysum Species from South Africa: A Review." Plants 10, no. 8: 1566.
Parkinson’s disease (PD) is one of the most common neurodegenerative diseases and affects approximately 6.3 million people worldwide. To date, the treatment of PD remains a challenge, as available treatment options are known to be associated with serious side effects; hence, the search for new treatment strategies is critical. Extracts from the Amaryllidaceae plant family as well as their alkaloids have been reported to have neuroprotective potentials. This study, therefore, investigated the biological activities of Crossyne flava and its isolated alkaloids in an in vitro MPP+ (1-methyl-4-phenylpyridinium) PD model using SH-SY5Y cells. The effects of the total extract as well as the four compounds isolated from Crossyne flava (i.e., pancratinine B (1), bufanidrine (2), buphanisine (3), and epibuphanisine (4)) were evaluated for cell viability, neuroprotection, levels of reactive oxygen species (ROS), adenosine triphosphate activity (ATP), and caspase 3/7 activity in SH-SY5Y cells. The results obtained showed that pre-treatment with both the extract and the isolated compounds was effective in protecting the SH-SY5Y cells from MPP+-induced neurotoxicity and inhibited ROS generation, ATP depletion as well as apoptosis induction in the SH-SY5Y cells. The results of this study show that the Amaryllidaceae plant family may be a source of novel compounds for the treatment of neurodegenerative diseases, which validates the reported traditional uses.
Sylvester Omoruyi; Abobaker Ibrakaw; Okobi Ekpo; James Boatwright; Christopher Cupido; Ahmed Hussein. Neuroprotective Activities of Crossyne flava Bulbs and Amaryllidaceae Alkaloids: Implications for Parkinson’s Disease. Molecules 2021, 26, 3990 .
AMA StyleSylvester Omoruyi, Abobaker Ibrakaw, Okobi Ekpo, James Boatwright, Christopher Cupido, Ahmed Hussein. Neuroprotective Activities of Crossyne flava Bulbs and Amaryllidaceae Alkaloids: Implications for Parkinson’s Disease. Molecules. 2021; 26 (13):3990.
Chicago/Turabian StyleSylvester Omoruyi; Abobaker Ibrakaw; Okobi Ekpo; James Boatwright; Christopher Cupido; Ahmed Hussein. 2021. "Neuroprotective Activities of Crossyne flava Bulbs and Amaryllidaceae Alkaloids: Implications for Parkinson’s Disease." Molecules 26, no. 13: 3990.
With high absorption coefficient (104 cm−1), optimal bandgap (∼1.5 eV), low toxicity and the abundance of its constituent elements, kesterite (Cu2ZnSnS4 or CZTS) displays the properties of an ideal photovoltaic material. Kesterite is structurally analogous to chalcopyrite (Cu2InGaS2 or CIGS) and can thus be produced through the already established techniques for the synthesis of commercial CIGS. Though CIGS- and CdTe-based thin-film solar cells have attained levels of power efficiency values (up to ∼22%) that compare with that of crystalline silicon-based wafer solar cell, they contain rare earth elements (indium and tellurium, respectively) and Cd is toxic. This article reviews the crystal structure formation and properties of CZTS. Material synthesis, thin-film deposition methodologies and different layers that have been developed for kesterite-based photovoltaic (PV) cell are reported. Factors that hinder high-power conversion efficiency, including large open-circuit voltage deficit (Voc,def), are discussed. Strategies, such as alloy formation, which has been employed as a way to overcome the limitations of using kesterite in PV cell applications are presented, together with the future direction in the quest for improving the performance of kesterite PV cell devices.
Kelechi C. Nwambaekwe; Vivian Suru John-Denk; Samantha F. Douman; Penny Mathumba; Sodiq T. Yussuf; Onyinyechi V. Uhuo; Precious I. Ekwere; Emmanuel I. Iwuoha. Crystal engineering and thin-film deposition strategies towards improving the performance of kesterite photovoltaic cell. Journal of Materials Research and Technology 2021, 12, 1252 -1287.
AMA StyleKelechi C. Nwambaekwe, Vivian Suru John-Denk, Samantha F. Douman, Penny Mathumba, Sodiq T. Yussuf, Onyinyechi V. Uhuo, Precious I. Ekwere, Emmanuel I. Iwuoha. Crystal engineering and thin-film deposition strategies towards improving the performance of kesterite photovoltaic cell. Journal of Materials Research and Technology. 2021; 12 ():1252-1287.
Chicago/Turabian StyleKelechi C. Nwambaekwe; Vivian Suru John-Denk; Samantha F. Douman; Penny Mathumba; Sodiq T. Yussuf; Onyinyechi V. Uhuo; Precious I. Ekwere; Emmanuel I. Iwuoha. 2021. "Crystal engineering and thin-film deposition strategies towards improving the performance of kesterite photovoltaic cell." Journal of Materials Research and Technology 12, no. : 1252-1287.
Metal chalcogenides such as copper zinc tin sulfide (CZTS) have been intensively studied as potential photovoltaic cell materials, but their viability have been marred by crystal defects and low open circuit potential (V oc) deficit, which affected their energy conversion efficiency. Strategies to improve on the properties of this material such as alloying with other elements have been explored and have yielded promising results. Here, we report the synthesis of CZTS and the partial substitution of S with Te via anion hot injection synthesis method to form a solid solution of a novel kesterite nanomaterial, namely, copper zinc tin sulfide telluride (CZTSTe). Particle-size analyzed via small angle X-ray scattering spectroscopy (SAXS) confirmed that CZTS and CZTSTe materials are nanostructured. Crystal planes values of 112, 200, 220 and 312 corresponding to the kesterite phase with tetragonal modification were revealed by the X-ray diffraction (XRD) spectroscopic analysis of CZTS and CZTSTe. The Raman spectroscopy confirmed the shifts at 281 cm−1 and 347 cm−1 for CZTS, and 124 cm−1, 149 cm−1 and 318 cm−1 for CZTSTe. High degradation rate and the production of hot electrons are very detrimental to the lifespan of photovoltaic cell (PVC) devices, and thus it is important to have PVC absorber layer materials that are thermally stable. Thermogravimetric analysis (TGA) analysis indicated a 10% improvement in the thermal stability of CZTSTe compared to CZTS at 650 °C. With improved electrical conductivity, low charge transfer resistance (R ct) and absorption in the visible region with a low bandgap energy (E g) of 1.54 eV, the novel CZTSTe nanomaterials displayed favorable properties for photovoltaics application.
Kelechi Nwambaekwe; Milua Masikini; Penny Mathumba; Morongwa Ramoroka; Samantha Duoman; Vivian John-Denk; Emmanuel Iwuoha. Electronics of Anion Hot Injection-Synthesized Te-Functionalized Kesterite Nanomaterial. Nanomaterials 2021, 11, 794 .
AMA StyleKelechi Nwambaekwe, Milua Masikini, Penny Mathumba, Morongwa Ramoroka, Samantha Duoman, Vivian John-Denk, Emmanuel Iwuoha. Electronics of Anion Hot Injection-Synthesized Te-Functionalized Kesterite Nanomaterial. Nanomaterials. 2021; 11 (3):794.
Chicago/Turabian StyleKelechi Nwambaekwe; Milua Masikini; Penny Mathumba; Morongwa Ramoroka; Samantha Duoman; Vivian John-Denk; Emmanuel Iwuoha. 2021. "Electronics of Anion Hot Injection-Synthesized Te-Functionalized Kesterite Nanomaterial." Nanomaterials 11, no. 3: 794.
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, l-leucine; R, l-arginine) (MC-LR) containing a 5′ thiolated 60-mer DNA aptamer (i.e., 5′-SH-(CH2)6GGCGCCAAACAGGACCACCATGACAATTACCCATACCACCTCATTATGCCCCATCT CCGC-3′). A nanocomposite electrode platform comprising biocompatible poly(2,5-dimethoxyaniline) (PDMA)-poly(vinylsulfonate) (PVS) and silver nanoparticle (Ag0) on a glassy carbon electrode (GCE), i.e., (GCE/PDMA–PVS–Ag0) was used in the biosensor development. Small-angle X-ray scattering (SAXS) spectroscopic analysis revealed that the PDMA–PVS–Ag0 nanocomposites were polydispersed and contained embedded Ag0. Electrochemical impedance spectroscopy (EIS) responses of the aptasensor gave a dynamic linear range (DLR) and limit of detection (LOD) values of 0.01–0.1 ng L−1 MC-LR and 0.003 ng L−1 MC-LR, respectively. The cross-reactivity studies, which was validated with enzyme-linked immunosorbent assay (ELISA), showed that the aptasensor possesses excellent selectivity for MC-LR.
Mawethu Pascoe Bilibana; Usisipho Feleni; Avril Rae Williams; Emmanuel Iwuoha. Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite. Processes 2021, 9, 179 .
AMA StyleMawethu Pascoe Bilibana, Usisipho Feleni, Avril Rae Williams, Emmanuel Iwuoha. Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite. Processes. 2021; 9 (1):179.
Chicago/Turabian StyleMawethu Pascoe Bilibana; Usisipho Feleni; Avril Rae Williams; Emmanuel Iwuoha. 2021. "Impedimetric Microcystin-LR Aptasensor Prepared with Sulfonated Poly(2,5-dimethoxyaniline)–Silver Nanocomposite." Processes 9, no. 1: 179.
This report focuses on the synthesis of novel 2,3,4,5-tetrathienylthiophene-co-poly(3-hexylthiophene-2,5-diyl) (TTT-co-P3HT) as a donor material for organic solar cells (OSCs). The properties of the synthesized TTT-co-P3HT were compared with those of poly(3-hexylthiophene-2,5-diyl (P3HT). The structure of TTT-co-P3HT was studied using nuclear magnetic resonance spectroscopy (NMR) and Fourier-transform infrared spectroscopy (FTIR). It was seen that TTT-co-P3HT possessed a broader electrochemical and optical band-gap as compared to P3HT. Cyclic voltammetry (CV) was used to determine lowest unoccupied molecular orbital (LUMO) and highest occupied molecular orbital (HOMO) energy gaps of TTT-co-P3HT and P3HT were found to be 2.19 and 1.97 eV, respectively. Photoluminescence revealed that TTT-co-P3HT:PC71BM have insufficient electron/hole separation and charge transfer when compared to P3HT:PC71BM. All devices were fabricated outside a glovebox. Power conversion efficiency (PCE) of 1.15% was obtained for P3HT:PC71BM device and 0.14% was obtained for TTT-co-P3HT:PC71BM device. Further studies were done on fabricated OSCs during this work using electrochemical methods. The studies revealed that the presence of poly(3,4-ethylenedioxythiophene) polystyrene sulfonate (PEDOT:PSS) on the surface of indium tin oxide (ITO) causes a reduction in cyclic voltammogram oxidation/reduction peak current and increases the charge transfer resistance in comparison with a bare ITO. We also examined the ITO/PEDOT:PSS electrode coated with TTT-co-P3HT:PC71BM, TTT-co-P3HT:PC71BM/ZnO, P3HT:PC71BM and P3HT:PC71BM/ZnO. The study revealed that PEDOT:PSS does not completely block electrons from active layer to reach the ITO electrode.
Morongwa E. Ramoroka; Siyabonga B. Mdluli; Vivian S. John-Denk; Kwena D. Modibane; Christopher J. Arendse; Emmanuel I. Iwuoha. Synthesis and Photovoltaics of Novel 2,3,4,5-Tetrathienylthiophene-co-poly(3-hexylthiophene-2,5-diyl) Donor Polymer for Organic Solar Cell. Polymers 2020, 13, 2 .
AMA StyleMorongwa E. Ramoroka, Siyabonga B. Mdluli, Vivian S. John-Denk, Kwena D. Modibane, Christopher J. Arendse, Emmanuel I. Iwuoha. Synthesis and Photovoltaics of Novel 2,3,4,5-Tetrathienylthiophene-co-poly(3-hexylthiophene-2,5-diyl) Donor Polymer for Organic Solar Cell. Polymers. 2020; 13 (1):2.
Chicago/Turabian StyleMorongwa E. Ramoroka; Siyabonga B. Mdluli; Vivian S. John-Denk; Kwena D. Modibane; Christopher J. Arendse; Emmanuel I. Iwuoha. 2020. "Synthesis and Photovoltaics of Novel 2,3,4,5-Tetrathienylthiophene-co-poly(3-hexylthiophene-2,5-diyl) Donor Polymer for Organic Solar Cell." Polymers 13, no. 1: 2.
A generation 1 poly(propylene thiophenoimine)-co-poly(ethylenedioxy thiophene) (G1PPT-co-PEDOT) star copolymer, which exhibits a strong optical absorption over a broad range in the ultraviolet–visible (UV-Vis) region and with good electro/conductive properties, was chemically prepared for the first time. Synthesis of the star copolymer, G1PPT-co-PEDOT was confirmed by spectroscopic studies. Indeed, the disappearance of the very high intensity bands, C–H bending at α-position (687 cm−1), and C=N stretching (1620 cm−1) in the Fourier transform infrared spectroscopy (FTIR) of G1PPT-co-PEDOT, which were initially present in the spectrum of the thiolated starting material, G1PPT, confirmed copolymerization. Furthermore, a large bathochromic shift in the onset wavelength of the UV-Vis absorbance spectra from 367 nm in G1PPT to 674 nm in G1PPT-co-PEDOT further attests of successful copolymerization. The electrochemical analysis of G1PPT-co-PEDOT achieved a highest occupied molecular orbital (HOMO) energy level value of 5.3 eV, which is reminiscent of the value for an ideal electron-donor material. Photoluminescence quenching of up to 82% was observed in solution blends of the G1PPT-co-PEDOT star copolymer and N,N′-diisopropyl naphthalene diimide (NDI). This demonstrates the occurrence of photoinduced intermolecular charge transfer (PICT) from the electron-donating G1PPT-co-PEDOT to the electron accepting NDI, a good property, beneficial for optoelectronic and photovoltaic applications.
Anne Lutgarde Djoumessi Yonkeu; Miranda Mengwi Ndipingwi; Chinwe Ikpo; Kelechi Nwambaekwe; Sodiq Yussuf; Hayelom Tesfay; Emmanuel Iwuoha. Photoluminescence Quenching of a Novel Electroconductive Poly(propylene thiophenoimine)-co-Poly(ethylenedioxy thiophene) Star Copolymer. Polymers 2020, 12, 2894 .
AMA StyleAnne Lutgarde Djoumessi Yonkeu, Miranda Mengwi Ndipingwi, Chinwe Ikpo, Kelechi Nwambaekwe, Sodiq Yussuf, Hayelom Tesfay, Emmanuel Iwuoha. Photoluminescence Quenching of a Novel Electroconductive Poly(propylene thiophenoimine)-co-Poly(ethylenedioxy thiophene) Star Copolymer. Polymers. 2020; 12 (12):2894.
Chicago/Turabian StyleAnne Lutgarde Djoumessi Yonkeu; Miranda Mengwi Ndipingwi; Chinwe Ikpo; Kelechi Nwambaekwe; Sodiq Yussuf; Hayelom Tesfay; Emmanuel Iwuoha. 2020. "Photoluminescence Quenching of a Novel Electroconductive Poly(propylene thiophenoimine)-co-Poly(ethylenedioxy thiophene) Star Copolymer." Polymers 12, no. 12: 2894.
Diabetes mellitus (DM) is one of the most dangerous metabolic diseases with a high rate of mortality worldwide. It is well known that insulin resistance and deficiency in insulin production from pancreatic β-cells are the main characteristics of DM. Due to the detrimental side effects of the current treatment, there is a considerable need to develop new effective antidiabetic drugs, especially alpha-glucosidase and alpha-amylase inhibitors with lesser adverse effects. These inhibitors are known to be directly involved in the delay of carbohydrate digestion, resulting in a reduction of glucose absorption rate and, consequently, reducing the postprandial rise of plasma glucose, which can reduce the risk of long-term diabetes complications. Furthermore, natural products are well-known sources for the discovery of new bioactive compounds that can serve as scaffolds for drug discovery, including that of new antidiabetic drugs. The phytochemical investigation of Salvia aurita collected from Hogobach Pass, Eastern Cape Province, South Africa (SA), yielded four known abietane diterpenes namely carnosol (1), rosmanol (2), 7-methoxyrosmanol (3), 12-methoxycarnosic acid (4), and one flavonoid named 4,7-dimethylapigenin (5). Structural characterization of these isolated compounds was conducted using 1 and 2D NMR, in comparison with reported spectroscopic data. These compounds are reported for the first time from S. aurita. The biological evaluation of the isolated compound against alpha-glucosidase exhibited strong inhibitory activities for 3 and 2 with the half maximal inhibitory concentration (IC50) values of 4.2 ± 0.7 and 16.4 ± 1.1 µg/mL respectively, while 4 and 1 demonstrated strong alpha-amylase inhibitory activity amongst the isolated compounds with IC50 values of 16.2 ± 0.3 and 19.8 ± 1.4 µg/mL. Molecular docking analysis confirms the strong inhibitory activity of 3 against alpha-glucosidase. Additionally, excellent antioxidant capacities were displayed by 2, 1, and 3, respectively, with oxygen radical absorbance capacity (ORAC) (25.79 ± 0.01; 23.96 ± 0.01; 23.94 ± 0.02) mM Trolox equivalent (TE)/g; 1 and 2 as ferric-ion reducing antioxidant power (FRAP) (3.92 ± 0.002; 1.52 ± 0.002) mM ascorbic acid equivalent (AAE)/g; 5 and 2 as Trolox equivalent absorbance capacity (TEAC) (3.19 ± 0.003; 2.06 ± 0.003) mM TE/g. The methanolic extract of S. aurita is a rich source of abietane diterpenes with excellent antioxidant and antidiabetic activities that can be useful to modulate oxidative stress and might possibly be excellent candidates for the management of diabetes. This is the first scientific report on the phytochemical isolation and biological evaluation of the alpha-glucosidase and alpha-amylase inhibitory activities of Salvia aurita.
Ninon G. E. R. Etsassala; Jelili A. Badmus; Jeanine L. Marnewick; Emmanuel I. Iwuoha; Felix Nchu; Ahmed A. Hussein. Alpha-Glucosidase and Alpha-Amylase Inhibitory Activities, Molecular Docking, and Antioxidant Capacities of Salvia aurita Constituents. Antioxidants 2020, 9, 1149 .
AMA StyleNinon G. E. R. Etsassala, Jelili A. Badmus, Jeanine L. Marnewick, Emmanuel I. Iwuoha, Felix Nchu, Ahmed A. Hussein. Alpha-Glucosidase and Alpha-Amylase Inhibitory Activities, Molecular Docking, and Antioxidant Capacities of Salvia aurita Constituents. Antioxidants. 2020; 9 (11):1149.
Chicago/Turabian StyleNinon G. E. R. Etsassala; Jelili A. Badmus; Jeanine L. Marnewick; Emmanuel I. Iwuoha; Felix Nchu; Ahmed A. Hussein. 2020. "Alpha-Glucosidase and Alpha-Amylase Inhibitory Activities, Molecular Docking, and Antioxidant Capacities of Salvia aurita Constituents." Antioxidants 9, no. 11: 1149.
A cytochrome P450 3A4 (CYP3A4) based enzymatic biosensor was developed with the incorporation of a first‐generation copper polypropyleneimine (CuPPI) metallodendrimer for the detection of anti‐tuberculosis (anti‐TB) drugs. The development of an electrochemical phenotype biosensor for this purpose is still vital since it aids in the ongoing fight against TB by determining metabolic profile. This allows TB treatment to be tailored on an individual patient basis, minimise adverse drug reactions and improve quality of life in TB patients. This simple biosensor was constructed via physical adsorption of CuPPI onto a gold electrode with subsequent electrostatic attachment of CYP3A4. The biosensor was successful in detecting all four first line anti‐TB drugs i. e. isoniazid, ethambutol, pyrazinamide and rifampicin with limits of detection ranging from 0.02244 to 0.1072 nM in 0.1 M phosphate buffer. The developed biosensor was then applied towards “real samples” in the form of spiked synthetic urine and plasma. Calibration curves were carried out in the complex matrices, which were diluted with 0.1 M PB. These yielded good LOD in the range of ultra‐low micromolar concentration i. e. 0.165–0.884 μM across all drugs. Recovery studies were also successful when detecting the real tablets in both plasma and urine with results ranging from 91.5 % to 108.5 %.
Candice Franke; Rachel Fanelwa Ajayi; Onyinyechi Uhuo; Kaylin Januarie; Emmanuel Iwuoha. Metallodendrimer‐sensitised Cytochrome P450 3A4 Electrochemical Biosensor for TB Drugs. Electroanalysis 2020, 32, 3075 -3085.
AMA StyleCandice Franke, Rachel Fanelwa Ajayi, Onyinyechi Uhuo, Kaylin Januarie, Emmanuel Iwuoha. Metallodendrimer‐sensitised Cytochrome P450 3A4 Electrochemical Biosensor for TB Drugs. Electroanalysis. 2020; 32 (12):3075-3085.
Chicago/Turabian StyleCandice Franke; Rachel Fanelwa Ajayi; Onyinyechi Uhuo; Kaylin Januarie; Emmanuel Iwuoha. 2020. "Metallodendrimer‐sensitised Cytochrome P450 3A4 Electrochemical Biosensor for TB Drugs." Electroanalysis 32, no. 12: 3075-3085.
Herein, a simple inkjet printing procedure on photographic paper is reported for the fabrication of electrochemical sensors. A two‐step approach for fabrication and modification of the electrode surface with a graphene, gold nanoparticle (ERGO‐AuNP) film, to improve electrode sensitivity and selectivity was employed and compared commercial brands. The printed paper‐based electrodes offer a quantitative analysis of Ni(II), based on the accumulation of Ni(dmgH)2 complexes at the modified electrode surface by square‐wave adsorptive cathodic stripping voltammetry (SW‐AdCSV). Improved sensitivities were achieved at the modified electrodes with a limit of detection of 32.19 µg L‐1 well below the EPA and WHO standards.
Keagan Pokpas; Nazeem Jahed; Earl McDonald; Petrone Bezuidenhoudt; Suzanne Smith; Kevin Land; Emmanuel Iwuoha. Graphene‐AuNP Enhanced Inkjet‐printed Silver Nanoparticle Paper Electrodes for the Detection of Nickel(II)‐Dimethylglyoxime [Ni(dmgH 2 )] Complexes by Adsorptive Cathodic Stripping Voltammetry (AdCSV). Electroanalysis 2020, 32, 3017 -3031.
AMA StyleKeagan Pokpas, Nazeem Jahed, Earl McDonald, Petrone Bezuidenhoudt, Suzanne Smith, Kevin Land, Emmanuel Iwuoha. Graphene‐AuNP Enhanced Inkjet‐printed Silver Nanoparticle Paper Electrodes for the Detection of Nickel(II)‐Dimethylglyoxime [Ni(dmgH 2 )] Complexes by Adsorptive Cathodic Stripping Voltammetry (AdCSV). Electroanalysis. 2020; 32 (12):3017-3031.
Chicago/Turabian StyleKeagan Pokpas; Nazeem Jahed; Earl McDonald; Petrone Bezuidenhoudt; Suzanne Smith; Kevin Land; Emmanuel Iwuoha. 2020. "Graphene‐AuNP Enhanced Inkjet‐printed Silver Nanoparticle Paper Electrodes for the Detection of Nickel(II)‐Dimethylglyoxime [Ni(dmgH 2 )] Complexes by Adsorptive Cathodic Stripping Voltammetry (AdCSV)." Electroanalysis 32, no. 12: 3017-3031.
Malignant primary brain tumours are reported to be the leading cause of death from solid tumours in children and the third leading cause of death from cancer in adolescents and adults. Current treatment options include surgery, radiation and chemotherapy. Despite these treatment options, patient survival still remains poor. The Amaryllidaceae family contains alkaloids which have shown several biological activities including the treatment of Alzheimer's disease. This study investigates the cytotoxic activity of the methanolic extracts of fourteen plants belonging to the Amaryllidaceae family in brain tumour cell lines. The MTT (3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) cell viability assay was used to determine the effects of plant extracts on cell viability while routine antioxidant assays were conducted to determine the antioxidant activities of the extracts. Results showed that of the fourteen extracts, five (Cyrtanthus breviflorus, Amaryllis belladonna, Crinum variabile, Haemanthus pubescens, Nerine filifolia) showed cytotoxicity in all the cell lines tested with IC50 values under 100 µg/mL. Six extracts (Crinum moorei, Clivia miniata, Haemanthus amarylloides, Crossyne guttata, Nerine humilis, and Ammocharis longifolia) showed varying levels of cytotoxicity in the cell lines tested and were unable to induce 50% reduction in cell viability across the cell lines tested at the highest concentration of 100 µg/mL. Furthermore, three plant extracts (Brunsvigia bosmaniae, Boophone disticha, Strumaria truncata) had minimal or no cytotoxic effects on all cell lines tested when compared to control. The extracts also showed varying degrees of antioxidant activity but were not as potent as the positive control. Findings from this study suggest that species of the Amaryllidaceae family may be useful sources of phytochemicals for the treatment of central nervous system cancers and should be further explored in animal models of central nervous system (CNS) and other cancer types.
Sylvester I. Omoruyi; Tusekile S. Kangwa; Abobaker S. Ibrakaw; Christopher N. Cupido; Jeanine L Marnewick; Okobi E. Ekpo; Ahmed A. Hussein. Cytotoxic activities of selected plants of the family Amaryllidaceae on brain tumour cell lines. South African Journal of Botany 2020, 136, 118 -125.
AMA StyleSylvester I. Omoruyi, Tusekile S. Kangwa, Abobaker S. Ibrakaw, Christopher N. Cupido, Jeanine L Marnewick, Okobi E. Ekpo, Ahmed A. Hussein. Cytotoxic activities of selected plants of the family Amaryllidaceae on brain tumour cell lines. South African Journal of Botany. 2020; 136 ():118-125.
Chicago/Turabian StyleSylvester I. Omoruyi; Tusekile S. Kangwa; Abobaker S. Ibrakaw; Christopher N. Cupido; Jeanine L Marnewick; Okobi E. Ekpo; Ahmed A. Hussein. 2020. "Cytotoxic activities of selected plants of the family Amaryllidaceae on brain tumour cell lines." South African Journal of Botany 136, no. : 118-125.
The prevalence of diabetes mellitus (DM), considered one of the most common metabolic disorders, has dramatically increased and resulted in higher rates of morbidity and mortality around the world in the past decade. It is well known that insulin resistance in target tissues and a deficiency in insulin secretion from pancreatic β-cells are the main characteristics of type 2 diabetes. The aim of this study was the bio-evaluation of compounds isolated from three selected plant species: namely, Salvia africana-lutea, Leonotis ocymifolia, and Plectranthus madagascariensis, for their glucose-uptake ability. Methanolic extracts were produced from the aerial parts of each plant. Compounds were identified using different spectroscopic techniques. The glucose-uptake ability of each compound was then evaluated in mammalian cells using 2-deoxyglucose-6-phosphate. The cytotoxicity of each compound was established via the MTT assay. Chromatographic purification of the three plant species yielded sixteen pure terpenoids. Compounds 1 (p = 0.0031), 8 (p = 0.0053), and 6 (p = 0.0086) showed a marked increase in glucose uptake, respectively. Additionally, 1, 4, and 6 exhibited cytotoxicity toward mammalian tissue with a decrease in cell viability of ~70%, ~68%, and ~67%, respectively. The results suggested that several compounds demonstrated a marked increase in glucose uptake, while two of the compounds exhibited signs of cytotoxicity. It may, therefore, be suggested that these compounds be considered as potential candidates for novel plant-derived alternative therapies in the treatment of type 2 diabetes.
Ninon G. E. R. Etsassala; Kadidiatou O. Ndjoubi; Thilly J. Mbira; Brendon Pearce; Keenau Pearce; Emmanuel I. Iwuoha; Ahmed A. Hussein; Mongi Benjeddou. Glucose-Uptake Activity and Cytotoxicity of Diterpenes and Triterpenes Isolated from Lamiaceae Plant Species. Molecules 2020, 25, 4129 .
AMA StyleNinon G. E. R. Etsassala, Kadidiatou O. Ndjoubi, Thilly J. Mbira, Brendon Pearce, Keenau Pearce, Emmanuel I. Iwuoha, Ahmed A. Hussein, Mongi Benjeddou. Glucose-Uptake Activity and Cytotoxicity of Diterpenes and Triterpenes Isolated from Lamiaceae Plant Species. Molecules. 2020; 25 (18):4129.
Chicago/Turabian StyleNinon G. E. R. Etsassala; Kadidiatou O. Ndjoubi; Thilly J. Mbira; Brendon Pearce; Keenau Pearce; Emmanuel I. Iwuoha; Ahmed A. Hussein; Mongi Benjeddou. 2020. "Glucose-Uptake Activity and Cytotoxicity of Diterpenes and Triterpenes Isolated from Lamiaceae Plant Species." Molecules 25, no. 18: 4129.
The chemical investigation of the nonpolar constituents of a methanol extract of the bulbs of Boophone haemanthoides yielded ten known compounds as minor constituents. The compounds were identified as stigmast-4-ene-3,6-dione (1); cholest-4-en-3-one (2); (22E)-stigmast-4,22-dien-3-one (3); stigmast-4-en-3-one (4); 6β-hydroxystigmast-4-en-3-one (5); 6β-hydroxycholest-4-en-3-one (6); cycloartenol (7); acetovanillone (8); tyrosol (10) and 3-hydroxy-1-(4-hydroxyphenyl)-1-propanone (11). The isolation of compound 7 with other cholestane (2, 6) and stigmastane (1, 3–5) derivatives aligned with the biosynthetic pathway of plant steroids through 7 from squalene 2,3-epoxide. This is the first report on the isolation and identification of these compounds from B. haemanthoides and 1–6 and 11 for the family Amaryllidaceae.
A.S. Ibrakaw; J.S. Boatwright; T. Lesch; C.N. Cupido; A.A. Hussein. Triterpenes and other minor chemical constituents of Boophone haemanthoides F.M. Leight (Amaryllidaceae). South African Journal of Botany 2020, 136, 35 -39.
AMA StyleA.S. Ibrakaw, J.S. Boatwright, T. Lesch, C.N. Cupido, A.A. Hussein. Triterpenes and other minor chemical constituents of Boophone haemanthoides F.M. Leight (Amaryllidaceae). South African Journal of Botany. 2020; 136 ():35-39.
Chicago/Turabian StyleA.S. Ibrakaw; J.S. Boatwright; T. Lesch; C.N. Cupido; A.A. Hussein. 2020. "Triterpenes and other minor chemical constituents of Boophone haemanthoides F.M. Leight (Amaryllidaceae)." South African Journal of Botany 136, no. : 35-39.
A novel nanobiosensor was constructed with graphene oxide (GO) sheets coupled to pear extract-based green-synthesised silver nanoparticles (Ag-NPs) to which cytochrome P450-2D6 (CYP2D6) enzyme was attached. The biosensor was applied in the electrochemical detection of the tuberculosis (TB) treatment drugs, ethambutol (EMB) and pyrazinamide (PZA). The surface morphology of the green-synthesised nanocomposites was studied by performing High-Resolution Transmission Electron Microscopy (HR-TEM) and High-Resolution Scanning Electron Microscopy (HR-SEM). Fourier Transform Infrared Spectroscopy (FTIR) and Raman Spectroscopy were used for structural analysis, while Ultraviolet Visible (UV-Vis) Spectroscopy was used in the optical characterisation of the nanocomposite material. Electrochemical studies on glassy carbon electrode (GCE), which were done by Cyclic Voltammetry (CV), showed that the GO|Ag-NPs||GCE electrode was highly conductive, and thereby indicating its suitability as a platform for nanobiosensor development. The non-toxic and low-cost green GO|Ag-NPs|CYP2D6||GCE nanobiosensor was used to determine EMB and PZA. The very low limit of detection (LOD) values of the biosensor for EMB (0.2962 × 10−2 nM, S/N = 3) and PZA (0.897 × 10−2 nM, S/N = 3) demonstrate that the green nanobiosensor is more sensitive than other biosensors reported for EMB and PZA.
Rachel Fanelwa Ajayi; Siphokazi Tshoko; Yonela Mgwili; Siphamandla Nqunqa; Takalani Mulaudzi; Noluthando Mayedwa; Emmanuel Iwuoha. Green Method Synthesised Graphene-Silver Electrochemical Nanobiosensors for Ethambutol and Pyrazinamide. Processes 2020, 8, 879 .
AMA StyleRachel Fanelwa Ajayi, Siphokazi Tshoko, Yonela Mgwili, Siphamandla Nqunqa, Takalani Mulaudzi, Noluthando Mayedwa, Emmanuel Iwuoha. Green Method Synthesised Graphene-Silver Electrochemical Nanobiosensors for Ethambutol and Pyrazinamide. Processes. 2020; 8 (7):879.
Chicago/Turabian StyleRachel Fanelwa Ajayi; Siphokazi Tshoko; Yonela Mgwili; Siphamandla Nqunqa; Takalani Mulaudzi; Noluthando Mayedwa; Emmanuel Iwuoha. 2020. "Green Method Synthesised Graphene-Silver Electrochemical Nanobiosensors for Ethambutol and Pyrazinamide." Processes 8, no. 7: 879.
Diabetes mellitus (DM) is considered one of the most common metabolic disorders with an elevated morbidity and mortality rate. It is characterised by a deficiency in insulin secretion or degradation of secreted insulin. Many internal and external factors, such as oxidative stress, obesity and sedentary lifestyle, among others, have been suggested as the major causes of these cell alterations. Diabetes I and II are the most common types of diabetes. Treatment of type I requires insulin injection, while type II can be managed using different synthetic antidiabetic agents. However, their effectiveness is limited as a result of low bioavailability, high cost of drug production, and unfavourable side effects. There is a great need to develop alternative and more active antidiabetic drugs from natural sources. Different forms of natural products have been used since time immemorial as a source of medicine for the purpose of curing numerous human diseases, including diabetes. Secondary metabolites such as polyphenols, flavonoids, terpenoids, alkaloids and several other constituents have direct and indirect roles in controlling such diseases; among them, abietane diterpenes have been reported to display a broad spectrum of promising biological activities including diabetes. This review aimed to summarize existing data from SciFinder (2005-2018) on the biological importance of abietane diterpenes in the prevention and management of type 2 diabetes and closely related diseases.
Ninon G.E.R. Etsassala; Christopher N. Cupido; Emmanuel I. Iwuoha; Ahmed A. Hussein. Abietane Diterpenes as Potential Candidates for the Management of Type 2 Diabetes. Current Pharmaceutical Design 2020, 26, 2885 -2891.
AMA StyleNinon G.E.R. Etsassala, Christopher N. Cupido, Emmanuel I. Iwuoha, Ahmed A. Hussein. Abietane Diterpenes as Potential Candidates for the Management of Type 2 Diabetes. Current Pharmaceutical Design. 2020; 26 (24):2885-2891.
Chicago/Turabian StyleNinon G.E.R. Etsassala; Christopher N. Cupido; Emmanuel I. Iwuoha; Ahmed A. Hussein. 2020. "Abietane Diterpenes as Potential Candidates for the Management of Type 2 Diabetes." Current Pharmaceutical Design 26, no. 24: 2885-2891.
Parkinson's disease (PD) is one of the most common neurodegenerative diseases (NDD) and mainly affects the ageing population. A significant feature of PD pathogenesis is the progressive loss of dopaminergic neurons in the substantia nigra pars compacta part of the midbrain in affected persons. This neuronal loss occurs partly due to the increased generation of reactive oxygen species (ROS) in the mitochondrial and the depletion of adenosine triphosphate (ATP) in affected neurons. In this study, the methanolic extracts of Clivia miniata (CME) and Nerine humilis (NHE) belonging to the plant family Amaryllidaceae, were investigated for their neuroprotective potential in MPP+-induced neurotoxicity in SH-SY5Y neuroblastoma cells. Cell viability was determined using the 3-(4,5-dimethyithiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays and cell morphology was analysed using light microscopy. Furthermore, the effects of the extracts on apoptosis and ATP production were investigated using caspase 3/7 apoptosis kit and the Promega Mitochondrial ToxGlo ATP assay kit respectively. Additionally, the antioxidant contents of extracts were evaluated using routine laboratory procedures. The results show that pre-treatment of cells with the extracts at 2 and 4 μg/mL concentrations improved cell viability as well as cell morphology by inhibiting the toxicity induced by MPP+. The extracts also improved ATP levels in cells and attenuated the apoptosis induced by MPP+. Furthermore, antioxidant assays showed that both extracts had low antioxidant activity. Findings from this study indicate that CME and NHE may be promising as neuroprotective agents for PD and warrant further investigation to determine the bioactive components of the plants that may be responsible for the observed effects.
Sylvester I. Omoruyi; Joshua Delport; Tusekile S. Kangwa; Abobaker S. Ibrakaw; Christopher N. Cupido; Okobi E. Ekpo; Ahmed A. Hussein. In vitro neuroprotective potential of Clivia miniata and Nerine humilis (Amaryllidaceae) in MPP+-induced neuronal toxicity in SH-SY5Y neuroblastoma cells. South African Journal of Botany 2020, 136, 110 -117.
AMA StyleSylvester I. Omoruyi, Joshua Delport, Tusekile S. Kangwa, Abobaker S. Ibrakaw, Christopher N. Cupido, Okobi E. Ekpo, Ahmed A. Hussein. In vitro neuroprotective potential of Clivia miniata and Nerine humilis (Amaryllidaceae) in MPP+-induced neuronal toxicity in SH-SY5Y neuroblastoma cells. South African Journal of Botany. 2020; 136 ():110-117.
Chicago/Turabian StyleSylvester I. Omoruyi; Joshua Delport; Tusekile S. Kangwa; Abobaker S. Ibrakaw; Christopher N. Cupido; Okobi E. Ekpo; Ahmed A. Hussein. 2020. "In vitro neuroprotective potential of Clivia miniata and Nerine humilis (Amaryllidaceae) in MPP+-induced neuronal toxicity in SH-SY5Y neuroblastoma cells." South African Journal of Botany 136, no. : 110-117.
Salinity is a major constraint limiting plant growth and productivity worldwide. Thus, understanding the mechanism underlying plant stress response is of importance to developing new approaches that will increase salt tolerance in crops. This study reports the effects of salt stress on Sorghum bicolor during germination and the role of calcium (Ca2+) to ameliorate some of the effects of salt. To this end, sorghum seeds were germinated in the presence and absence of different NaCl (200 and 300 mM) and Ca2+ (5, 15, or 35 mM) concentrations. Salt stress delayed germination, reduced growth, increased proline, and hydrogen peroxide (H2O2) contents. Salt also induced the expression of key antioxidant (ascorbate peroxidase and catalase) and the Salt Overlay Sensitive1 genes, whereas in the presence of Ca2+ their expression was reduced except for the vacuolar Na+/H+ exchanger antiporter2 gene, which increased by 65-fold compared to the control. Ca2+ reversed the salt-induced delayed germination and promoted seedling growth, which was concomitant with reduced H2O2 and Na+/K+ ratio, indicating a protective effect. Ca2+ also effectively protected the sorghum epidermis and xylem layers from severe damage caused by salt stress. Taken together, our findings suggest that sorghum on its own responds to high salt stress through modulation of osmoprotectants and regulation of stress-responsive genes. Finally, 5 mM exogenously applied Ca2+ was most effective in enhancing salt stress tolerance by counteracting oxidative stress and improving Na+/K+ ratio, which in turn improved germination efficiency and root growth in seedlings stressed by high NaCl.
Takalani Mulaudzi; Kaylin Hendricks; Thembeka Mabiya; Mpho Muthevhuli; Rachel Fanelwa Ajayi; Noluthando Mayedwa; Christoph Gehring; Emmanuel Iwuoha. Calcium Improves Germination and Growth of Sorghum bicolor Seedlings under Salt Stress. Plants 2020, 9, 1 .
AMA StyleTakalani Mulaudzi, Kaylin Hendricks, Thembeka Mabiya, Mpho Muthevhuli, Rachel Fanelwa Ajayi, Noluthando Mayedwa, Christoph Gehring, Emmanuel Iwuoha. Calcium Improves Germination and Growth of Sorghum bicolor Seedlings under Salt Stress. Plants. 2020; 9 (6):1.
Chicago/Turabian StyleTakalani Mulaudzi; Kaylin Hendricks; Thembeka Mabiya; Mpho Muthevhuli; Rachel Fanelwa Ajayi; Noluthando Mayedwa; Christoph Gehring; Emmanuel Iwuoha. 2020. "Calcium Improves Germination and Growth of Sorghum bicolor Seedlings under Salt Stress." Plants 9, no. 6: 1.
Copper selenide quantum dot (CuSeQD) materials functionalised with mercaptoalkanoic acids {3‐mercaptopropionic acid (3‐MPA), 6‐mercaptohexanoic acid (6‐MHA) and mercaptosuccinic acid (MSA)} were synthesized by a reproducible aqueous colloidal technique at room temperature. The impact of the capping agents on the size and the crystallinity of the CuSeQD materials, were investigated by small angle X‐ray scattering (SAXS) and X‐ray diffraction (XRD) spectroscopic techniques, respectively. SAXS results confirmed that 6‐MHA‐CuSeQD had the smallest average particle core size when dried, whereas MSA‐CuSeQD had the smallest size in aqueous solution, though with a tendency to aggregate. Dynamic light scattering (DLS) measurements indicated strong bonding of the capping agents to CuSe particles, with MSA being the weakest binding agent, as confirmed by comparatively, low Zeta potential(ζ=−31.1 mV) and high polydispersity index (0.469) values. UV‐Vis absorption studies confirmed a large blue shift of the band gap for the QD compared to the bulk material, with characteristic absorption band (λ) and direct band gap (Egd) values being (λ=435 nm, Egd=8.0 eV), (λ=400 nm, Egd=5.6 eV) and (λ=340 nm, Egd=4.0 eV), for 6‐MHA‐CuSeQD, 3‐MPA‐CuSeQD and MSA‐CuSeQD, respectively. As supported by the formal potential values for 6‐MHA‐CuSeQD (E0′≈120 mV), 3‐MPA‐CuSeQD (E0′≈159 mV) and MSA‐CuSeQD (E0′≈183 mV), the smaller the particle size, the lower the potential required for the application of the quantum dots in an electron transfer process.
Laura C. Pacoste; Abongile N. Jijana; Usisipho Feleni; Emmanuel Iwuoha. Mercaptoalkanoic Acid‐Induced Band Gap Attenuation of Copper Selenide Quantum Dot. ChemistrySelect 2020, 5, 4994 -5005.
AMA StyleLaura C. Pacoste, Abongile N. Jijana, Usisipho Feleni, Emmanuel Iwuoha. Mercaptoalkanoic Acid‐Induced Band Gap Attenuation of Copper Selenide Quantum Dot. ChemistrySelect. 2020; 5 (16):4994-5005.
Chicago/Turabian StyleLaura C. Pacoste; Abongile N. Jijana; Usisipho Feleni; Emmanuel Iwuoha. 2020. "Mercaptoalkanoic Acid‐Induced Band Gap Attenuation of Copper Selenide Quantum Dot." ChemistrySelect 5, no. 16: 4994-5005.
To address aggravating environmental and energy problems, active, efficient, low-cost, and robust electrocatalysts (ECs) are actively pursued as substitutes for the current noble metal ECs. Therefore, in this study, we report the preparation of graphene flakes (GF) doped with S and N using 2-5-dimercapto-1,3,4-thiadiazole (S3N2) as precursor followed by the immobilization of cobalt spinel oxide (Co3O4) or manganese spinel oxide (Mn3O4) nanoparticles through a one-step co-precipitation procedure (Co/S3N2–GF and Mn/S3N2–GF). Characterization by different physicochemical techniques (Fourier Transform Infrared (FTIR), Raman spectroscopy, Transmission Electron Microscopy (TEM) and X-ray Diffraction (XRD)) of both composites shows the preservation of the metal oxide spinel structure and further confirms the successful preparation of the envisaged electrocatalysts. Co/S3N2–GF composite exhibits the best ORR performance with an onset potential of 0.91 V vs. RHE, a diffusion-limiting current density of −4.50 mA cm−2 and selectivity for the direct four-electron pathway, matching the results obtained for commercial Pt/C. Moreover, both Co/S3N2–GF and Mn/S3N2–GF showed excellent tolerance to methanol poisoning and good stability.
Penny Mathumba; Diana M. Fernandes; Renata Matos; Emmanuel I. Iwuoha; Cristina Freire. Metal Oxide (Co3O4 and Mn3O4) Impregnation into S, N-doped Graphene for Oxygen Reduction Reaction (ORR). Materials 2020, 13, 1562 .
AMA StylePenny Mathumba, Diana M. Fernandes, Renata Matos, Emmanuel I. Iwuoha, Cristina Freire. Metal Oxide (Co3O4 and Mn3O4) Impregnation into S, N-doped Graphene for Oxygen Reduction Reaction (ORR). Materials. 2020; 13 (7):1562.
Chicago/Turabian StylePenny Mathumba; Diana M. Fernandes; Renata Matos; Emmanuel I. Iwuoha; Cristina Freire. 2020. "Metal Oxide (Co3O4 and Mn3O4) Impregnation into S, N-doped Graphene for Oxygen Reduction Reaction (ORR)." Materials 13, no. 7: 1562.
Several biosensors based on the immobilization of alkaline phosphatase (ALP) at different transducers have been reported in literature. In this work, a gold electrode covalently modified with a hydrogel (Au-HGL) was used as a platform for the immobilization of ALP enzyme to produce Au-HGL/ALP biosensor. The biosensor construction was evaluated by Raman spectroscopy, cyclic voltammetry (CV), and atomic force microscopy (AFM). The analytical performance of the biosensor was assessed by square wave voltammetry (SWV), electrochemical impedance spectroscopy (EIS), and amperometry. The calibration curve displayed a dynamic linear range of 0.5–30 μM with a detection limit (LOD) and quantification limit (LOQ) of 0.23 μM and 0.76 μM, respectively. Determination of vanadium in commercial Centrum® tablet using the proposed biosensor was satisfactory when compared to other analytical methods. The proposed Au-HGL/ALP biosensor exhibited high sensitivity to vanadium in an aqueous medium with a good reproducibility (n = 4) and a relative standard deviation (RSD) of 8.0%. Graphical Abstract
Francis N. Muya; Priscilla G. L. Baker; Emmanuel I. Iwuoha. Polysulfone Hydrogel Nanocomposite Alkaline Phosphatase Biosensor for the Detection of Vanadium. Electrocatalysis 2020, 11, 374 -382.
AMA StyleFrancis N. Muya, Priscilla G. L. Baker, Emmanuel I. Iwuoha. Polysulfone Hydrogel Nanocomposite Alkaline Phosphatase Biosensor for the Detection of Vanadium. Electrocatalysis. 2020; 11 (4):374-382.
Chicago/Turabian StyleFrancis N. Muya; Priscilla G. L. Baker; Emmanuel I. Iwuoha. 2020. "Polysulfone Hydrogel Nanocomposite Alkaline Phosphatase Biosensor for the Detection of Vanadium." Electrocatalysis 11, no. 4: 374-382.