Background: Sesame (Sesamum indicumL., 2n = 2x = 26) is an important oilseed crop with high oil content but small seed size. To reveal the genetic loci of the quantitative seed-related traits, we constructed a high-density single nucleotide polymorphism (SNP) linkage map of an F₂population by using specific length amplified fragment (SLAF) technique and determined the quantitative trait loci (QTLs) of seed-related traits for sesame based on the phenotypes of F₃progeny.Results: The genetic map comprised 2159 SNP markers distributed on 13 linkage groups (LGs) and was 2128.51 cM in length, with an average distance of 0.99 cM between adjacent markers. QTL mapping revealed 19 major-effect QTLs with the phenotypic effect (R²) more than 10%, i.e., eight QTLs for seed coat color, nine QTLs for seed size, and two QTLs for 1000-seed weight (TSW), using composite interval mapping method. Particularly, LG04 and LG11 contained collocated QTL regions for the seed coat color and seed size traits, respectively, based on their close or identical locations. In total, 155 candidate genes for seed coat color, 22 for seed size traits, and 54 for TSW were screened and analyzed.Conclusions: This report presents the first QTL mapping of seed-related traits in sesame using an F₂population. The results reveal the location of specific markers associated with seed-related traits in sesame and provide the basis for further seed quality traits research.

Faba bean (Vicia faba L.) is a valuable legume crop and data on its seed-related traits is required for yield and quality improvements. However, basic research on faba bean is lagging compared to that of other major crops. In this study, an F₂ faba bean population, including 121 plants derived from the cross WY7×TCX7, was genotyped using the Faba_bean_130 K targeted next-generation sequencing genotyping platform. The data were used to construct the first ultra-dense faba bean genetic map consisting of 12,023 single nucleotide polymorphisms markers covering 1,182.65 cM with an average distance of 0.098 cM. The map consisted of 6 linkage groups, which is consistent with the 6 faba bean chromosome pairs. A total of 65 quantitative trait loci (QTL) for seed-related traits were identified (3 for 100-seed weight, 28 for seed shape, 12 for seed coat color, and 22 for nutritional quality). Furthermore, 333 candidate genes that are likely to participate in the regulation of seed-related traits were also identified. Our research findings can provide a basis for future faba bean marker-assisted breeding and be helpful to further modify and improve the reference genome.

Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

Seed priming, a valuable seed pretreatment method widely employed in agricultural production, counteracts the decline in seed vigor attributed to aging and deterioration. However, PEG priming effectively enhances the vigor of aged soybean seeds. In this study, “TONGDOU13” soybean seeds were subjected to PEG-6000 priming at varying concentrations (10%, 20%, 30%, 40%) for three different durations (12 h, 24 h, 36 h). The results showed that a 24 h priming with 30% PEG-6000 significantly enhances the vigor of aged soybean seeds. To elucidate the mechanism underlying the heightened vigor resulting from PEG-6000 priming, we employed transcriptome sequencing and physiological–biochemical tests. Transcriptome sequencing analysis showed the significant down-regulation of carbon metabolism-related genes post PEG-6000 priming, which facilitated energetically efficient germination. Five peroxidase-encoding genes displayed significant up-regulation, promoting the conversion of coumaryl alcohol to hydroxy-phenyl lignin, a probable catalyst for augmented seed vigor. SOD and GST genes were significantly up-regulated, enhancing the scavenging ability of reactive oxygen species (ROS). The concurrent up-regulation of brassinolide (BR) and auxin (IAA) signals countered ABA signaling, thereby promoting aged seed germination. Further investigation included the measurements of antioxidant enzyme activity, hormone levels, and lignin content. Notably, primed aged seeds exhibited enhanced ROS scavenging ability, and increased lignin, BR, and IAA contents. Therefore, PEG priming may improve aged soybean seed vigor through the co-regulation of carbon metabolism, ROS scavenging, hormone signaling, and lignin synthesis. This study will be vital for preserving germplasm resources and reutilizing aged soybean seeds.

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.