Sesame (Sesamum indicum L.) is one of the oldest oilseed crops. In order to investigate the evolutionary characters according to the Sesame Genome Project, apart from sequencing its nuclear genome, we sequenced the complete chloroplast genome of S. indicum cv. Yuzhi 11 (white seeded) using Illumina and 454 sequencing. Comparisons of chloroplast genomes between S. indicum and the 18 other higher plants were then analyzed. The chloroplast genome of cv. Yuzhi 11 contains 153,338 bp and a total of 114 unique genes (KC569603). The number of chloroplast genes in sesame is the same as that in Nicotiana tabacum, Vitis vinifera and Platanus occidentalis. The variation in the length of the large single-copy (LSC) regions and inverted repeats (IR) in sesame compared to 18 other higher plant species was the main contributor to size variation in the cp genome in these species. The 77 functional chloroplast genes, except for ycf1 and ycf2, were highly conserved. The deletion of the cp ycf1 gene sequence in cp genomes may be due either to its transfer to the nuclear genome, as has occurred in sesame, or direct deletion, as has occurred in Panax ginseng and Cucumis sativus. The sesame ycf2 gene is only 5,721 bp in length and has lost about 1,179 bp. Nucleotides 1–585 of ycf2 when queried in BLAST had hits in the sesame draft genome. Five repeats (R10, R12, R13, R14 and R17) were unique to the sesame chloroplast genome. We also found that IR contraction/expansion in the cp genome alters its rate of evolution. Chloroplast genes and repeats display the signature of convergent evolution in sesame and other species. These findings provide a foundation for further investigation of cp genome evolution in Sesamum and other higher plants.

Sesame is an important oil crop for the high oil content and quality. The seed oil and protein contents are two important traits in sesame. To identify the molecular markers associated with the seed oil and protein contents in sesame, we systematically performed the association mapping among 369 worldwide germplasm accessions under 5 environments using 112 polymorphic SSR markers. The general linear model (GLM) was applied with the criteria of logP≥3.0 and high stability under all 5 environments. Among the 369 sesame accessions, the oil content ranged from 27.89%–58.73% and the protein content ranged from 16.72%–27.79%. A significant negative correlation of the oil content with the protein content was found in the population. A total of 19 markers for oil content were detected with a R² value range from 4% to 29%; 24 markers for protein content were detected with a R² value range from 3% to 29%, of which 19 markers were associated with both traits. Moreover, partial markers were confirmed using mixed linear model (MLM) method, which suggested that the oil and protein contents are controlled mostly by major genes. Allele effect analysis showed that the allele associated with high oil content was always associated with low protein content, and vice versa. Of the 19 markers associated with oil content, 17 presented near the locations of the plant lipid pathway genes and 2 were located just next to a fatty acid elongation gene and a gene encoding Stearoyl-ACP Desaturase, respectively. The findings provided a valuable foundation for oil synthesis gene identification and molecular marker assistant selection (MAS) breeding in sesame.

Background: Sesame (Sesamum indicumL., 2n = 2x = 26) is an important oilseed crop with high oil content but small seed size. To reveal the genetic loci of the quantitative seed-related traits, we constructed a high-density single nucleotide polymorphism (SNP) linkage map of an F₂population by using specific length amplified fragment (SLAF) technique and determined the quantitative trait loci (QTLs) of seed-related traits for sesame based on the phenotypes of F₃progeny.Results: The genetic map comprised 2159 SNP markers distributed on 13 linkage groups (LGs) and was 2128.51 cM in length, with an average distance of 0.99 cM between adjacent markers. QTL mapping revealed 19 major-effect QTLs with the phenotypic effect (R²) more than 10%, i.e., eight QTLs for seed coat color, nine QTLs for seed size, and two QTLs for 1000-seed weight (TSW), using composite interval mapping method. Particularly, LG04 and LG11 contained collocated QTL regions for the seed coat color and seed size traits, respectively, based on their close or identical locations. In total, 155 candidate genes for seed coat color, 22 for seed size traits, and 54 for TSW were screened and analyzed.Conclusions: This report presents the first QTL mapping of seed-related traits in sesame using an F₂population. The results reveal the location of specific markers associated with seed-related traits in sesame and provide the basis for further seed quality traits research.

Starch is the most widespread and abundant storage carbohydrate in crops and its production is critical to both crop yield and quality. In regard to the starch content in the seeds of crop plants, there is a distinct difference between grasses (Poaceae) and dicots. However, few studies have described the evolutionary pattern of genes in the starch biosynthetic pathway in these two groups of plants. In this study, therefore, an attempt was made to compare evolutionary rate, gene duplication, and selective pattern of the key genes involved in this pathway between the two groups, using five grasses and five dicots as materials. The results showed 1) distinct differences in patterns of gene duplication and loss between grasses and dicots; duplication in grasses mainly occurred before the divergence of grasses, whereas duplication mostly occurred in individual species within the dicots; there is less gene loss in grasses than in dicots, 2) a considerably higher evolutionary rate in grasses than in dicots in most gene families analyzed, and 3) evidence of a different selective pattern between grasses and dicots; positive selection may have occurred asymmetrically in grasses in some gene families, for example, ADP-glucose pyrophosphorylase small subunit. Therefore, we deduced that gene duplication contributes to, and a higher evolutionary rate is associated with, the higher starch content in grasses. In addition, two novel aspects of the evolution of the starch biosynthetic pathway were observed.

Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.