Leaf shape can affect plantlet development and seed yield in sesame. The morphological, histological and genetic analyses of a sesame mutant cl1 (cl) with curly leaf and indehiscent capsule traits were performed in this study. In order to clone the cl1 gene for breeding selection, genome re-sequencing of the 130 individuals of cl1 × USA (0)-26 F2 population and a bulked segregation analysis (BSA) pool was carried out. The genome re-sequencing data of the 822 germplasm with normal leaf shape were applied. For cl1 mutant, the adaxial/abaxial character of the parenchyma cells in the leaf blades is reduced. Results proved that the leaf curling trait is controlled by a recessive gene (Sicl1). Cross- population association of the F2 population of cl1 × USA (0)-26 indicated that the target cl locus was located on the interval C29 between C29_6522236 and C29_6918901 of SiChr. 1. Further regional genome variants screening determined the 6 candidate variants using genomic variants data of 822 natural germplasm and a BSA pool data. Of which, 5 markers C29_6717525, C29_6721553, C29_6721558, C29_6721563, and C29_6721565 existed in the same gene (C29.460). With the aid of the validation in the test F2 population of cl1 × Yuzhi 11 and natural germplasm, the integrated marker SiCLInDel1 (C29: 6721553–6721572) was determined as the target marker, and C29.460 was the target gene SiCL1 in sesame. SiCL1 is a KAN1 homolog with the full length of 6835 bp. In cl1, the 20 nucleic acids (CAGGTAGCTATGTATATGCA) of SiCLInDel1 marker were mutagenized into 6 nucleic acids (TCTTTG). The deletion led to a frameshift mutation and resulted in the earlier translation termination of the CL gene. The Sicl1 allele was shortened to 1829 bp. SiCL1 gene was expressed mainly in the tissues of stem, leaf, bud, capsule and seed. SiCL1 encodes a transcription repressor KAN1 protein and controls leaf curling and capsule indehiscence in sesame. The findings provided an example of high-efficient gene cloning in sesame. The SiCL1 gene and the cl1 mutant supply the opportunity to explore the development regulation of leaf and capsule, and would improve the new variety breeding with high harvest mechanization adaption in sesame.

Fusarium oxysporum f. sp. sesami is an extremely destructive pathogen, causing sesame Fusarium wilt disease worldwide. To clarify the pathogenicity and the genetic characters of F. oxysporum f. sp. sesami, we systematically investigated 69 F. oxysporum isolates collected from major sesame-growing areas in China. Among these isolates, 54 isolates were pathogenic and 15 were nonpathogenic according to pathogenicity testing on sesame seedlings. For the pathogenic isolates, three F. oxysporum f. sp. sesami pathogenicity groups were defined based on the three differential sesame hosts for the first time. A translation elongation factor 1α gene tree was constructed to determine the genetic diversity of the F. oxysporum isolates but could not separate F. oxysporum f. sp. sesami isolates from the nonpathogenic isolates and other F. oxysporum formae speciales. Ten secreted-in-xylem (SIX) genes (one family of effectors) were identified in F. oxysporum f. sp. sesami isolates by a search with the genome data, and were subsequently screened in the 69 F. oxysporum isolates. Compared with the SIX gene profiles in other F. oxysporum formae speciales, the presence and sequence variations of the SIX gene homologs directly correlated with the specific pathogenicity of F. oxysporum f. sp. sesami toward sesame. Furthermore, eight of these F. oxysporum f. sp. sesami SIX genes were significantly expressed in sesame plants as infection of the F. oxysporum f. sp. sesami isolate. These findings have important significance for understanding the pathogenic basis of F. oxysporum f. sp. sesami isolates, and will contribute to improve the diagnostics to effectively control Fusarium wilt disease in sesame.

Background: Sesame charcoal rot caused by Macrophomina phaseolina is one of the most serious fungal diseases in sesame production, and threatens the yield and quality of sesame. WAKL genes are important in the plant response to biotic stresses by sensing and transmitting external signals to the intracellular receptor. However, there is still a lack about the WAKL gene family and its function in sesame resistance to M. phaseolina. The aim of this study was to interpret the roles of WAKL genes in sesame resistance to M. phaseolina. Results: In this study, a comprehensive study of the WAKL gene family was conducted and 31 WAKL genes were identified in the sesame genome. Tandem duplication events were the main factor in expansion of the SiWAKL gene family. Phylogenetic analysis showed that the sesame SiWAKL gene family was divided into 4 groups. SiWAKL genes exhibited different expression patterns in diverse tissues. Under M. phaseolina stress, most SiWAKL genes were significantly induced. Notably, SiWAKL6 was strongly induced in the resistant variety “Zhengzhi 13”. Functional analysis showed that SiWAKL6 was induced by salicylic acid but not methyl jasmonate in sesame. Overexpression of SiWAKL6 in transgenic Arabidopsis thaliana plants enhanced their resistance to M. phaseolina by inducing the expression of genes involved in the salicylic acid signaling pathway and reconstructing reactive oxygen species homeostasis. Conclusions: Taken together, the results provide a better understanding of functions about SiWAKL gene family and suggest that manipulation of these SiWAKL genes can improve plant resistance to M. phaseolina. The findings contributed to further understanding of functions of SiWAKL genes in plant immunity.

Seed number per capsule (SNC) is a major factor influencing seed yield and is an important trait with complex gene interaction effects. We first performed genetic analysis, gene cloning, and molecular mechanism study for an EMS-induced sesame mutant cs1 with fewer SNC and shorter capsule length (CL). The mutant traits were due to the pleiotropism of a regressive gene (Sics1). Capsule hormone determination showed that five out of 12 hormones, including auxin indole-3-acetic acid (IAA), had significantly different levels between wild type (WT) and mutant type (MT). KEGG pathway analysis showed that plant hormone signal transduction, especially the auxin signal transduction pathway, was the most abundant differentially expressed signaling pathway. After the cross-population association and regional genome screening, we found that three homozygous loci were retained in cs1. Further analysis of these three loci resulted in the identification of SiCRC as the candidate gene for cs1. SiCRC consists of seven exons and six introns encoding 163 amino acids. The SiCRC in cs1 showed a point mutation at intron 5 and exon 6 junction, resulting in the splice site being frame-shifted eight nucleotides further downstream, causing incorrect splicing. Taken together, we assumed the SNP mutation in SiCRC disrupted the function of the transcription factor, which might act downstream of the CRC-auxin signal transduction pathway, resulting in a shorter CL and less SNC mutation of cs1 in sesame. Our results highlight the molecular framework underlying the transcription factor CRC-mediated role of auxin transduction in SNC and CL development.