This page has only limited features, please log in for full access.

Dr. Jessica Henkel
Gulf Coast Ecosystem Restoration Council

Basic Info


Research Keywords & Expertise

0 science and technology policy
0 Coastal restoration
0 ecosystem restoration
0 shorebirds
0 data synthesis

Fingerprints

shorebirds
Coastal restoration
data synthesis

Honors and Awards

The user has no records in this section


Career Timeline

The user has no records in this section.


Short Biography

The user biography is not available.
Following
Followers
Co Authors
The list of users this user is following is empty.
Following: 0 users

Feed

Journal article
Published: 14 March 2020 in Shore & Beach
Reads 0
Downloads 0

This paper presents a summary of collaborative work, lessons learned, and suggestions for next steps in coordinating long-term data management in the Gulf of Mexico in the years following the Deepwater Horizon oil spill (DWH). A decade of increased research and monitoring following the DWH has yielded a vast amount of diverse data collected from response and assessment efforts as well as ongoing restoration efforts. To maximize the benefits of this data through proper management and coordination, a cross-agency and organization Long-Term Data Management (LTDM) working group was established in 2017 with sponsorship from NOAA’s Office of Response and Restoration (OR&R) and NOAA’s National Marine Fisheries Service Restoration Center (NMFS RC) and facilitated by the University of New Hampshire’s Coastal Response Research Center. This paper will describe the LTDM working group’s efforts to foster collaboration, data sharing, and best data management practices among the many state, federal, academic and non-governmental entities working to restore and improve the coastal environment in the Gulf following the DWH. Through collaborative workshops and working groups, participants have helped to characterize region-specific challenges, identify areas for growth, leverage existing connections, and develop recommended actions for stakeholders at all organizational levels who share an interest in data coordination and management activities.

ACS Style

Kathryn Keating; Melissa Gloekler; Nancy Kinner; Sharon Mesick; Michael Peccini; Benjamin Shorr; Lauren Showalter; Jessica Henkel. Coordination of long-term data management in the Gulf of Mexico: Lessons learned and recommendations from two years of cross-agency collaboration. Shore & Beach 2020, 17 -22.

AMA Style

Kathryn Keating, Melissa Gloekler, Nancy Kinner, Sharon Mesick, Michael Peccini, Benjamin Shorr, Lauren Showalter, Jessica Henkel. Coordination of long-term data management in the Gulf of Mexico: Lessons learned and recommendations from two years of cross-agency collaboration. Shore & Beach. 2020; ():17-22.

Chicago/Turabian Style

Kathryn Keating; Melissa Gloekler; Nancy Kinner; Sharon Mesick; Michael Peccini; Benjamin Shorr; Lauren Showalter; Jessica Henkel. 2020. "Coordination of long-term data management in the Gulf of Mexico: Lessons learned and recommendations from two years of cross-agency collaboration." Shore & Beach , no. : 17-22.

Journal article
Published: 13 March 2020 in Shore & Beach
Reads 0
Downloads 0

This paper provides a short review of the history and accomplishments of the largest funding allocations for research and restoration that have been made as a result of the DWH oil spill. This history provides an important context for the publications included in this 10-year commemoration issue dedicated to Deepwater Horizon.

ACS Style

Jessica Henkel; Alyssa Dausman. A short history of funding and accomplishments post-Deepwater Horizon. Shore & Beach 2020, 11 -16.

AMA Style

Jessica Henkel, Alyssa Dausman. A short history of funding and accomplishments post-Deepwater Horizon. Shore & Beach. 2020; ():11-16.

Chicago/Turabian Style

Jessica Henkel; Alyssa Dausman. 2020. "A short history of funding and accomplishments post-Deepwater Horizon." Shore & Beach , no. : 11-16.

Journal article
Published: 23 January 2020 in Sustainability
Reads 0
Downloads 0

In the United States, extensive investments have been made to restore the ecological function and services of coastal marine habitats. Despite a growing body of science supporting coastal restoration, few studies have addressed the suite of societally enabling conditions that helped facilitate successful restoration and recovery efforts that occurred at meaningful ecological (i.e., ecosystem) scales, and where restoration efforts were sustained for longer (i.e., several years to decades) periods. Here, we examined three case studies involving large-scale and long-term restoration efforts including the seagrass restoration effort in Tampa Bay, Florida, the oyster restoration effort in the Chesapeake Bay in Maryland and Virginia, and the tidal marsh restoration effort in San Francisco Bay, California. The ecological systems and the specifics of the ecological restoration were not the focus of our study. Rather, we focused on the underlying social and political contexts of each case study and found common themes of the factors of restoration which appear to be important for maintaining support for large-scale restoration efforts. Four critical elements for sustaining public and/or political support for large-scale restoration include: (1) resources should be invested in building public support prior to significant investments into ecological restoration; (2) building political support provides a level of significance to the recovery planning efforts and creates motivation to set and achieve meaningful recovery goals; (3) recovery plans need to be science-based with clear, measurable goals that resonate with the public; and (4) the accountability of progress toward reaching goals needs to be communicated frequently and in a way that the general public comprehends. These conclusions may help other communities move away from repetitive, single, and seemingly unconnected restoration projects towards more large-scale, bigger impact, and coordinated restoration efforts.

ACS Style

Bryan DeAngelis; Ariana Sutton-Grier; Allison Colden; Katie Arkema; Christopher Baillie; Richard Bennett; Jeff Benoit; Seth Blitch; Anthony Chatwin; Alyssa Dausman; Rachel Gittman; Holly Greening; Jessica Henkel; Rachel Houge; Ron Howard; A. Hughes; Jeremy Lowe; Steven Scyphers; Edward Sherwood; Stephanie Westby; Jonathan Grabowski. Social Factors Key to Landscape-Scale Coastal Restoration: Lessons Learned from Three U.S. Case Studies. Sustainability 2020, 12, 869 .

AMA Style

Bryan DeAngelis, Ariana Sutton-Grier, Allison Colden, Katie Arkema, Christopher Baillie, Richard Bennett, Jeff Benoit, Seth Blitch, Anthony Chatwin, Alyssa Dausman, Rachel Gittman, Holly Greening, Jessica Henkel, Rachel Houge, Ron Howard, A. Hughes, Jeremy Lowe, Steven Scyphers, Edward Sherwood, Stephanie Westby, Jonathan Grabowski. Social Factors Key to Landscape-Scale Coastal Restoration: Lessons Learned from Three U.S. Case Studies. Sustainability. 2020; 12 (3):869.

Chicago/Turabian Style

Bryan DeAngelis; Ariana Sutton-Grier; Allison Colden; Katie Arkema; Christopher Baillie; Richard Bennett; Jeff Benoit; Seth Blitch; Anthony Chatwin; Alyssa Dausman; Rachel Gittman; Holly Greening; Jessica Henkel; Rachel Houge; Ron Howard; A. Hughes; Jeremy Lowe; Steven Scyphers; Edward Sherwood; Stephanie Westby; Jonathan Grabowski. 2020. "Social Factors Key to Landscape-Scale Coastal Restoration: Lessons Learned from Three U.S. Case Studies." Sustainability 12, no. 3: 869.

Policy and practice reviews article
Published: 28 August 2019 in Frontiers in Marine Science
Reads 0
Downloads 0

Coastal ecosystems are under pressure from a vast array of anthropogenic stressors, including development and climate change, resulting in significant habitat losses globally. Conservation policies are often implemented with the intent of reducing habitat loss. However, losses already incurred will require restoration if ecosystem functions and services are to be recovered. The United States has a long history of wetland loss and recognizes that averting loss requires a multi-pronged approach including mitigation for regulated activities and non-mitigation (voluntary herein) restoration. The 1989 “No Net Loss” (NNL) policy stated the Federal government's intent that losses of wetlands would be offset by at least as many gains of wetlands. However, coastal wetlands losses result from both regulated and non-regulated activities. We examined the effectiveness of Federally funded, voluntary restoration efforts in helping avert losses of coastal wetlands by assessing: (1) What are the current and past trends in coastal wetland change in the U.S.?; and (2) How much and where are voluntary restoration efforts occurring? First, we calculated palustrine and estuarine wetland change in U.S. coastal shoreline counties using data from NOAA's Coastal Change Analysis Program, which integrates both types of potential losses and gains. We then synthesized available data on Federally funded, voluntary restoration of coastal wetlands. We found that from 1996 to 2010, the U.S. lost 139,552 acres (~565 km2) of estuarine wetlands (2.5% of 1996 area) and 336,922 acres (~1,363 km2) of palustrine wetlands (1.4%). From 2006 to 2015, restoration of 145,442 acres (~589 km2) of estuarine wetlands and 154,772 acres (~626 km2) of palustrine wetlands occurred. Further, wetland losses and restoration were not always geographically aligned, resulting in local and regional “winners” and “losers.” While these restoration efforts have been considerable, restoration and mitigation collectively have not been able to keep pace with wetland losses; thus, reversing this trend will likely require greater investment in coastal habitat conservation and restoration efforts. We further conclude that “area restored,” the most prevalent metric used to assess progress, is inadequate, as it does not necessarily equate to restoration of functions. Assessing the effectiveness of wetland restoration not just in the U.S., but globally, will require allocation of sufficient funding for long-term monitoring of restored wetland functions, as well as implementation of standardized methods for monitoring data collection, synthesis, interpretation, and application.

ACS Style

Rachel K. Gittman; Christopher J. Baillie; Katie K. Arkema; Richard O. Bennett; Jeff Benoit; Seth Blitch; Julien Brun; Anthony Chatwin; Allison Colden; Alyssa Dausman; Bryan DeAngelis; Nathaniel Herold; Jessica Henkel; Rachel Houge; Ronald Howard; A. Randall Hughes; Steven B. Scyphers; Tisa Shostik; Ariana Sutton-Grier; Jonathan H. Grabowski. Voluntary Restoration: Mitigation's Silent Partner in the Quest to Reverse Coastal Wetland Loss in the USA. Frontiers in Marine Science 2019, 6, 1 .

AMA Style

Rachel K. Gittman, Christopher J. Baillie, Katie K. Arkema, Richard O. Bennett, Jeff Benoit, Seth Blitch, Julien Brun, Anthony Chatwin, Allison Colden, Alyssa Dausman, Bryan DeAngelis, Nathaniel Herold, Jessica Henkel, Rachel Houge, Ronald Howard, A. Randall Hughes, Steven B. Scyphers, Tisa Shostik, Ariana Sutton-Grier, Jonathan H. Grabowski. Voluntary Restoration: Mitigation's Silent Partner in the Quest to Reverse Coastal Wetland Loss in the USA. Frontiers in Marine Science. 2019; 6 ():1.

Chicago/Turabian Style

Rachel K. Gittman; Christopher J. Baillie; Katie K. Arkema; Richard O. Bennett; Jeff Benoit; Seth Blitch; Julien Brun; Anthony Chatwin; Allison Colden; Alyssa Dausman; Bryan DeAngelis; Nathaniel Herold; Jessica Henkel; Rachel Houge; Ronald Howard; A. Randall Hughes; Steven B. Scyphers; Tisa Shostik; Ariana Sutton-Grier; Jonathan H. Grabowski. 2019. "Voluntary Restoration: Mitigation's Silent Partner in the Quest to Reverse Coastal Wetland Loss in the USA." Frontiers in Marine Science 6, no. : 1.

Management applications
Published: 05 August 2019 in Estuaries and Coasts
Reads 0
Downloads 0

Habitat and water quality restoration projects are commonly used to enhance coastal resources or mitigate the negative impacts of water quality stressors. Significant resources have been expended for restoration projects, yet much less attention has focused on evaluating broad regional outcomes beyond site-specific assessments. This study presents an empirical framework to evaluate multiple datasets in the Tampa Bay area (Florida, USA) to identify (1) the types of restoration projects that have produced the greatest improvements in water quality and (2) time frames over which different projects may produce water quality benefits. Information on the location and date of completion of 887 restoration projects from 1971 to 2017 were spatially and temporally matched with water quality records at each of the 45 long-term monitoring stations in Tampa Bay. The underlying assumption was that the developed framework could identify differences in water quality changes between types of restoration projects based on aggregate estimates of chlorophyll-a concentrations before and after the completion of one to many projects. Water infrastructure projects to control point source nutrient loading into the Bay were associated with the highest likelihood of chlorophyll-a reduction, particularly for projects occurring prior to 1995. Habitat restoration projects were also associated with reductions in chlorophyll-a, although the likelihood of reductions from the cumulative effects of these projects were less than those from infrastructure improvements alone. The framework is sufficiently flexible for application to different spatiotemporal contexts and could be used to develop reasonable expectations for implementation of future water quality restoration activities throughout the Gulf of Mexico.

ACS Style

Marcus W. Beck; Edward T. Sherwood; Jessica Renee Henkel; Kirsten Dorans; Kathryn Ireland; Patricia Varela. Assessment of the Cumulative Effects of Restoration Activities on Water Quality in Tampa Bay, Florida. Estuaries and Coasts 2019, 42, 1774 -1791.

AMA Style

Marcus W. Beck, Edward T. Sherwood, Jessica Renee Henkel, Kirsten Dorans, Kathryn Ireland, Patricia Varela. Assessment of the Cumulative Effects of Restoration Activities on Water Quality in Tampa Bay, Florida. Estuaries and Coasts. 2019; 42 (7):1774-1791.

Chicago/Turabian Style

Marcus W. Beck; Edward T. Sherwood; Jessica Renee Henkel; Kirsten Dorans; Kathryn Ireland; Patricia Varela. 2019. "Assessment of the Cumulative Effects of Restoration Activities on Water Quality in Tampa Bay, Florida." Estuaries and Coasts 42, no. 7: 1774-1791.

Journal article
Published: 19 June 2018 in Eos
Reads 0
Downloads 0

The Mississippi River and its delta and plume provide insights into research-informed approaches to managing river-dominated coastal zones.

ACS Style

Alexander S. Kolker; Alyssa M. Dausman; Mead A. Allison; Gary L. Brown; Philip Y. Chu; Kim de Mutsert; Catherine E. Fitzpatrick; Jessica Henkel; Dubravko Justić; Barbara A. Kleiss; Elizabeth McCoy; Ehab Meselhe; Carol Parsons Richards. Rethinking the River. Eos 2018, 99, 1 .

AMA Style

Alexander S. Kolker, Alyssa M. Dausman, Mead A. Allison, Gary L. Brown, Philip Y. Chu, Kim de Mutsert, Catherine E. Fitzpatrick, Jessica Henkel, Dubravko Justić, Barbara A. Kleiss, Elizabeth McCoy, Ehab Meselhe, Carol Parsons Richards. Rethinking the River. Eos. 2018; 99 ():1.

Chicago/Turabian Style

Alexander S. Kolker; Alyssa M. Dausman; Mead A. Allison; Gary L. Brown; Philip Y. Chu; Kim de Mutsert; Catherine E. Fitzpatrick; Jessica Henkel; Dubravko Justić; Barbara A. Kleiss; Elizabeth McCoy; Ehab Meselhe; Carol Parsons Richards. 2018. "Rethinking the River." Eos 99, no. : 1.

Journal article
Published: 16 June 2015 in PeerJ
Reads 0
Downloads 0

Benthic infaunal communities are important components of coastal ecosystems. Understanding the relationships between the structure of these communities and characteristics of the habitat in which they live is becoming progressively more important as coastal systems face increasing stress from anthropogenic impacts and changes in climate. To examine how sediment characteristics and infaunal community composition were related along the northern Gulf of Mexico coast, we sampled intertidal infaunal communities at seven sites covering common habitat types at a regional scale. Across 69 samples, the communities clustered into four distinct groups on the basis of faunal composition. Nearly 70% of the variation in the composition of the communities was explained by salinity, median grain size, and total organic content. Our results suggest that at a regional level coarse habitat characteristics are able to explain a large amount of the variation among sites in infaunal community structure. By examining the relationships between infaunal communities and their sedimentary habitats, we take a necessary first step that will allow the exploration of how changes in habitat and community composition influence higher trophic levels and ecosystem scale processes.

ACS Style

Kyle E. Coblentz; Jessica R. Henkel; Bryan Sigel; Caz M. Taylor. Influence of sediment characteristics on the composition of soft-sediment intertidal communities in the northern Gulf of Mexico. PeerJ 2015, 3, 1 .

AMA Style

Kyle E. Coblentz, Jessica R. Henkel, Bryan Sigel, Caz M. Taylor. Influence of sediment characteristics on the composition of soft-sediment intertidal communities in the northern Gulf of Mexico. PeerJ. 2015; 3 ():1.

Chicago/Turabian Style

Kyle E. Coblentz; Jessica R. Henkel; Bryan Sigel; Caz M. Taylor. 2015. "Influence of sediment characteristics on the composition of soft-sediment intertidal communities in the northern Gulf of Mexico." PeerJ 3, no. : 1.

Journal article
Published: 01 January 2015 in Animal Migration
Reads 0
Downloads 0

Twenty-eight species of migratory shorebirds rely on the coastlines of the northern Gulf of Mexico (NGOM) to fuel migrations to near-arctic breeding grounds. Shorebird species vary in their migration ecology: some species use a “jump” strategy, migrating long distances without stopping, while others use “skip” and “hop” strategies, stopping to refuel at shorter intervals along their journey. We compared stopover duration, body condition (fat scores and size-adjusted mass), and refueling rates (plasma metabolite concentrations), in three Calidrid sandpiper species (Calidris pusilla, C. mauri, and C. alpina) that differ in migration strategy after leaving the NGOM during spring. Results indicate that, while birds refueled at similar rates, C. alpina, an intermediate distance jump migrant, reached higher fuel stores before departing on migration than the hop and skip migrants, C. pusilla and C. mauri. C. alpina also spent more time on the NGOM than the other two species. Results suggest that NGOM habitats may be particularly important for migration success in C. alpina. This knowledge will help us predict the potential population level consequences of habitat loss due to global change on NGOM shorebird populations and develop conservation plans to mitigate these impacts.

ACS Style

Jessica Henkel; Caz M. Taylor. Migration strategy predicts stopover ecology in shorebirds on the northern Gulf of Mexico. Animal Migration 2015, 2, 63 -75.

AMA Style

Jessica Henkel, Caz M. Taylor. Migration strategy predicts stopover ecology in shorebirds on the northern Gulf of Mexico. Animal Migration. 2015; 2 (1):63-75.

Chicago/Turabian Style

Jessica Henkel; Caz M. Taylor. 2015. "Migration strategy predicts stopover ecology in shorebirds on the northern Gulf of Mexico." Animal Migration 2, no. 1: 63-75.

Journal article
Published: 25 November 2014 in Journal of Field Ornithology
Reads 0
Downloads 0
ACS Style

Jessica R. Henkel; Bryan Sigel; Caz M. Taylor. Oiling rates and condition indices of shorebirds on the northern Gulf of Mexico following the Deepwater Horizon oil spill. Journal of Field Ornithology 2014, 85, 408 -420.

AMA Style

Jessica R. Henkel, Bryan Sigel, Caz M. Taylor. Oiling rates and condition indices of shorebirds on the northern Gulf of Mexico following the Deepwater Horizon oil spill. Journal of Field Ornithology. 2014; 85 (4):408-420.

Chicago/Turabian Style

Jessica R. Henkel; Bryan Sigel; Caz M. Taylor. 2014. "Oiling rates and condition indices of shorebirds on the northern Gulf of Mexico following the Deepwater Horizon oil spill." Journal of Field Ornithology 85, no. 4: 408-420.

Journal article
Published: 10 June 2014 in Estuaries and Coasts
Reads 0
Downloads 0

For over a century, ecologists and evolutionary biologists have investigated the association between sedimentary characteristics and the infaunal communities inhabiting sediments. Relationships between infauna and, specifically, sediment grain size distributions, have provided a common methodology to predict the distributions, composition, and diversity of soft-sediment communities. Wet/dry sieve methods have traditionally been used to determine grain size distributions, but laser particle size analyzers are becoming increasingly popular and have been shown to measure sediment grain size distributions more efficiently and more accurately than wet/dry sieve methods. An additional, but underexplored, advantage of laser particle size analyzers is their ability to provide uncommonly reported or alternative grain size statistics that can be used to estimate sediment characteristics that are not easily measured using sieve techniques. In particular, measures of sediment heterogeneity are arbitrary and tedious to measure with previously used sieve and microscope techniques. Here, we propose that grain size coefficient of variation, measured using a particle size analyzer, is an improved metric for sediment heterogeneity. We show that grain size coefficient of variation is related to infaunal richness in intertidal habitats along the northern Gulf of Mexico matching previous results relating sediment heterogeneity to infaunal richness. We discuss the benefits and drawbacks of particle size analyzers and how the use of alternative metrics from laser particle size analyzers may assist the field of benthic ecology.

ACS Style

Kyle E. Coblentz; Jessica R. Henkel; Bryan Sigel; Caz M. Taylor. Technical Note: The Use of Laser Diffraction Particle Size Analyzers for Inference on Infauna-Sediment Relationships. Estuaries and Coasts 2014, 38, 699 -702.

AMA Style

Kyle E. Coblentz, Jessica R. Henkel, Bryan Sigel, Caz M. Taylor. Technical Note: The Use of Laser Diffraction Particle Size Analyzers for Inference on Infauna-Sediment Relationships. Estuaries and Coasts. 2014; 38 (2):699-702.

Chicago/Turabian Style

Kyle E. Coblentz; Jessica R. Henkel; Bryan Sigel; Caz M. Taylor. 2014. "Technical Note: The Use of Laser Diffraction Particle Size Analyzers for Inference on Infauna-Sediment Relationships." Estuaries and Coasts 38, no. 2: 699-702.

Journal article
Published: 01 July 2012 in BioScience
Reads 0
Downloads 0

The 2010 Deepwater Horizon oil spill, the largest ever accidental release of oil into marine waters, affected hundreds of miles of US northern Gulf of Mexico coastline that is important habitat for migratory shorebirds. Shorebirds are particularly susceptible to oil contamination because of their subsurface probe-foraging behavior and reliance on intertidal habitat. More than one million migratory shorebirds representing 28 species were potentially exposed to Deepwater Horizon oil during their 2010–2011 nonbreeding season. Although only 8.6% of the shorebirds trapped from fall 2010 to spring 2011 showed visible signs of oiling, nonlethal effects and degradation of habitat can affect populations in ways that carry over into subsequent seasons. Here, we discuss how the spill could affect populations of migratory shorebirds through acute mortality, as well as through long-term and indirect pathways. We also discuss the potential impacts on ecosystems far from the spill, including prairie grasslands and the Arctic, where migratory shorebirds breed.

ACS Style

Jessica R. Henkel; Bryan J. Sigel; Caz M. Taylor. Large-Scale Impacts of the Deepwater Horizon Oil Spill: Can Local Disturbance Affect Distant Ecosystems through Migratory Shorebirds? BioScience 2012, 62, 676 -685.

AMA Style

Jessica R. Henkel, Bryan J. Sigel, Caz M. Taylor. Large-Scale Impacts of the Deepwater Horizon Oil Spill: Can Local Disturbance Affect Distant Ecosystems through Migratory Shorebirds? BioScience. 2012; 62 (7):676-685.

Chicago/Turabian Style

Jessica R. Henkel; Bryan J. Sigel; Caz M. Taylor. 2012. "Large-Scale Impacts of the Deepwater Horizon Oil Spill: Can Local Disturbance Affect Distant Ecosystems through Migratory Shorebirds?" BioScience 62, no. 7: 676-685.

Research article
Published: 20 May 2011 in Zoo Biology
Reads 0
Downloads 0

The minimization of kinship in captive populations is usually achieved through the use of pedigree information. However, pedigree knowledge alone is not sufficient if pedigree information is missing, questionable, or when the founders of the captive population are related to one another. If this is the case, higher levels of inbreeding and lower levels of genetic diversity may be present in a captive population than those calculated by pedigree analyses alone. In this study, the genetic status of the critically endangered Mississippi sandhill crane (MSC) (Grus canadensis pulla) was analyzed using studbook data from the U.S. Fish and Wildlife Service managed captive breeding program as well as microsatellite DNA data. These analyses provided information on shared founder genotypes, allowing for refined analysis of genetic variation in the population, and the development of a new DNA‐based studbook pedigree that will assist in the genetic management of the MSC population. Zoo Biol 31:322–335, 2012.

ACS Style

Jessica R. Henkel; Kenneth L. Jones; Scott G. Hereford; Megan L. Savoie; S.P. Leibo; Jerome J. Howard. Integrating microsatellite and pedigree analyses to facilitate the captive management of the endangered Mississippi sandhill crane (Grus canadensis pulla). Zoo Biology 2011, 31, 322 -335.

AMA Style

Jessica R. Henkel, Kenneth L. Jones, Scott G. Hereford, Megan L. Savoie, S.P. Leibo, Jerome J. Howard. Integrating microsatellite and pedigree analyses to facilitate the captive management of the endangered Mississippi sandhill crane (Grus canadensis pulla). Zoo Biology. 2011; 31 (3):322-335.

Chicago/Turabian Style

Jessica R. Henkel; Kenneth L. Jones; Scott G. Hereford; Megan L. Savoie; S.P. Leibo; Jerome J. Howard. 2011. "Integrating microsatellite and pedigree analyses to facilitate the captive management of the endangered Mississippi sandhill crane (Grus canadensis pulla)." Zoo Biology 31, no. 3: 322-335.

Journal article
Published: 11 June 2010 in Conservation Genetics Resources
Reads 0
Downloads 0

Sequences for loci 24 and 25 are incorrect. The following primer sequences are the correct ones for Table 1.GRAM24CAGTCGGGCGTCATCAGCAAAGAGGAGGGAAGAATG TGAACATAGCAAGATCGTGGAGGRAM25CAGTCGGGCGTCATCACCTCACATGAAAGCCACTCAAAG AAGGGACGCTGTCTGCTTAGG CAGTCGGGCGTCATCAGCAAAGAGGAGGGAAGAATG TGAACATAGCAAGATCGTGGAG CAGTCGGGCGTCATCACCTCACATGAAAGCCACTCAAAG AAGGGACGCTGTCTGCTTAGG

ACS Style

Kenneth L. Jones; Jessica Henkel; Jerome J. Howard; Stacey Lance; Chris Hagen; Travis C. Glenn. Erratum to: Isolation and characterization of 14 polymorphic microsatellite DNA loci for the endangered Whooping Crane (Grus americana) and their applicability to other crane species. Conservation Genetics Resources 2010, 2, 255 -255.

AMA Style

Kenneth L. Jones, Jessica Henkel, Jerome J. Howard, Stacey Lance, Chris Hagen, Travis C. Glenn. Erratum to: Isolation and characterization of 14 polymorphic microsatellite DNA loci for the endangered Whooping Crane (Grus americana) and their applicability to other crane species. Conservation Genetics Resources. 2010; 2 (1):255-255.

Chicago/Turabian Style

Kenneth L. Jones; Jessica Henkel; Jerome J. Howard; Stacey Lance; Chris Hagen; Travis C. Glenn. 2010. "Erratum to: Isolation and characterization of 14 polymorphic microsatellite DNA loci for the endangered Whooping Crane (Grus americana) and their applicability to other crane species." Conservation Genetics Resources 2, no. 1: 255-255.

Journal article
Published: 13 February 2010 in Conservation Genetics Resources
Reads 0
Downloads 0

Fourteen microsatellite DNA loci were isolated from the endangered Whooping Crane (Grus americana) and genetic variability assessed from 45 captive reared individuals. Allele numbers detected at each locus ranged from 2 to 6, the highest seen for this species. Mean observed heterozygosity varied from 0.04 to 0.79. These markers were then successfully amplified for two non-migratory populations of Sandhill Crane [Florida (Grus canadensis pratensis) and Missisippi (Grus canadensis pulla)], underscoring their utility for the conservation of threatened crane species.

ACS Style

Kenneth L. Jones; Jessica R. Henkel; Jerome J. Howard; Stacey Lance; Chris Hagen; Travis Glenn. Isolation and characterization of 14 polymorphic microsatellite DNA loci for the endangered Whooping Crane (Grus americana) and their applicability to other crane species. Conservation Genetics Resources 2010, 2, 251 -254.

AMA Style

Kenneth L. Jones, Jessica R. Henkel, Jerome J. Howard, Stacey Lance, Chris Hagen, Travis Glenn. Isolation and characterization of 14 polymorphic microsatellite DNA loci for the endangered Whooping Crane (Grus americana) and their applicability to other crane species. Conservation Genetics Resources. 2010; 2 (1):251-254.

Chicago/Turabian Style

Kenneth L. Jones; Jessica R. Henkel; Jerome J. Howard; Stacey Lance; Chris Hagen; Travis Glenn. 2010. "Isolation and characterization of 14 polymorphic microsatellite DNA loci for the endangered Whooping Crane (Grus americana) and their applicability to other crane species." Conservation Genetics Resources 2, no. 1: 251-254.